View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_10 (Length: 335)

Name: NF0538_high_10
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_high_10
NF0538_high_10
[»] chr7 (1 HSPs)
chr7 (1-306)||(30906802-30907106)


Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 30906802 - 30907106
Alignment:
1 tatgaaccgtgtcccttccaaaagaaacaactcccacccaaattagaccttgtcgaaagccgaactaaaagcaattaccatgaaaagattaccacttttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30906802 tatgaaccgtgtcccttccaaaagaaacaactcccacccaaattagaccttgtcgaaagccgaactaaaagcaattaccatgaaaagattaccacttttg 30906901  T
101 aaggagcaaaacttccccacaccttagccaaaagactatacctatctgacaccaccaacaaataagatcgaagtgaatatatatttataaagatgagaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||  |||| ||||||||||||| ||||||||||||    
30906902 aaggagcaaaacttccccacaccttagccaaaagactatccctatctgacaccaccaacaaatagga-agaagagaatatatatttacaaagatgagaaa 30907000  T
201 gaatttggttcaccaaaaatatacctcgagagtttgcacacacaatcaatcatctttcaacatcaatagttggaccaacactactaactccaacaaactt 300  Q
    |||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||||| ||||||    
30907001 gaatttagtttaccaaaaatatacctcgagagtttgcacacacaaccaatcatctttcgacatcaatagttagaccaacactactaactccaataaactt 30907100  T
301 tggtag 306  Q
    ||||||    
30907101 tggtag 30907106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191826 times since January 2019
Visitors: 2831