View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_15 (Length: 287)

Name: NF0538_high_15
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_high_15
NF0538_high_15
[»] chr1 (1 HSPs)
chr1 (1-264)||(43469916-43470179)
[»] chr8 (2 HSPs)
chr8 (209-264)||(10642590-10642645)
chr8 (209-259)||(32713193-32713243)
[»] chr7 (1 HSPs)
chr7 (209-264)||(23924004-23924059)


Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 43469916 - 43470179
Alignment:
1 ctaagtgtgttgtttgttactttgagcatgttctccaactcaatgcacatgcattcacatgatgaattcttcttctcacatcatatacaccaaacaaaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43469916 ctaagtgtgttgtttgttactttgagcatgttctccaactcaatgcacatgcattcacatgatgaattcttcttctcacatcatatacaccaaacaaaac 43470015  T
101 ctctctatacaacaacctttcatcacaaacacacacctcatctaattaaaccacaccctggattattcctatacaactttccaaattcattgtatttaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43470016 ctctctatacaacaacctttcatcacaaacacacacctcatctaattaaaccacaccctggattattcctatacaactttccaaattcattgtatttaat 43470115  T
201 ttaattacaaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 264  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43470116 ttaattacaaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 43470179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 264
Target Start/End: Complemental strand, 10642645 - 10642590
Alignment:
209 aaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 264  Q
    |||||||||||||||| ||||| ||||||||||||||||||| || ||||||||||    
10642645 aaatccatcactctccatccagttcaataaacgtggcaacgtagcgtaaaacatgt 10642590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 259
Target Start/End: Original strand, 32713193 - 32713243
Alignment:
209 aaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaa 259  Q
    |||||||||||||||| ||||| ||||||||| ||||||||| || |||||    
32713193 aaatccatcactctccatccagttcaataaacatggcaacgtagcgtaaaa 32713243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 264
Target Start/End: Original strand, 23924004 - 23924059
Alignment:
209 aaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 264  Q
    |||||||||||||||| ||||| ||||||||||||||||||| || ||||||||||    
23924004 aaatccatcactctccatccagttcaataaacgtggcaacgtagcgtaaaacatgt 23924059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295169 times since January 2019
Visitors: 3016