View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_18 (Length: 267)

Name: NF0538_high_18
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_high_18
[»] chr2 (17 HSPs)
chr2 (1-258)||(30182250-30182507)
chr2 (3-258)||(30024743-30024998)
chr2 (3-258)||(30117124-30117379)
chr2 (3-258)||(30131881-30132136)
chr2 (3-258)||(30035699-30035954)
chr2 (3-258)||(30229837-30230092)
chr2 (3-258)||(30237130-30237385)
chr2 (1-238)||(30281355-30281592)
chr2 (3-256)||(30069865-30070118)
chr2 (49-258)||(30253764-30253973)
chr2 (3-236)||(30792403-30792636)
chr2 (57-255)||(30176640-30176838)
chr2 (3-165)||(30031816-30031978)
chr2 (3-165)||(30225954-30226116)
chr2 (28-236)||(30092441-30092649)
chr2 (28-236)||(30114294-30114502)
chr2 (28-236)||(30129046-30129254)

Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 17)
Name: chr2

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 30182250 - 30182507
1 aattgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttgg 100  Q
    |||||||||||||||||  ||||||||||||||| | | |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||    
30182250 aattgtttcagaatgtctggtgcattcgcttccatttgcaaatatatatgtgaaggaactacatgtcaccttaaggtttttgagattgatgaacctttgg 30182349  T
101 aggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcata 200  Q
    ||||||||||||||||||||||||||| || | |||||||||||||||  |||| |||||||||||| |||||||||||||||||| ||||||||||||     
30182350 aggaaaccagatggaaacttttcagacacatcgtgaaaacatcgcaagcaaagagctgttactgtgttgataagctcatcattaaggtgaccattgcatg 30182449  T
201 acatggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
     ||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||    
30182450 ccatggtgacatccttgctgttcagaataagctcccctttgttttggacaatctatga 30182507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 258
Target Start/End: Complemental strand, 30024998 - 30024743
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| ||||| |||||||||||| || || ||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||||    
30024998 ttgtttcagaatgtccagcgcatttgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagctttatgagattgataaacttttggag 30024899  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30024898 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30024799  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30024798 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30024743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30117124 - 30117379
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| ||||| |||||||||||| || || ||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||||    
30117124 ttgtttcagaatgtccagcgcatttgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagctttatgagattgataaacttttggag 30117223  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30117224 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30117323  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30117324 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30117379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30131881 - 30132136
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| ||||| |||||||||||| || || ||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||||    
30131881 ttgtttcagaatgtccagcgcatttgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagctttatgagattgataaacttttggag 30131980  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30131981 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30132080  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30132081 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30132136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30035699 - 30035954
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| |||||||||||||||||| || || ||||||||| |||||||||||||||||||  || |||||||||||||| |||||||    
30035699 ttgtttcagaatgtccagcgcattcgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagcattatgagattgataaacttttggag 30035798  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| |||||||||||||| |||||||||||||||||||||||    
30035799 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcaccattaagttgaccattgcataac 30035898  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30035899 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30035954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30229837 - 30230092
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| |||||||||||||||||| || || ||||||||| |||||||||||||||||||  || |||||||||||||| |||||||    
30229837 ttgtttcagaatgtccagcgcattcgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagcattatgagattgataaacttttggag 30229936  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| |||||||||||||| |||||||||||||||||||||||    
30229937 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcaccattaagttgaccattgcataac 30230036  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30230037 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30230092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30237130 - 30237385
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| |||||||||||||||||| || || ||||||||| |||||||||||||  |||| | | |||||||||||||| |||||||    
30237130 ttgtttcagaatgtccagcgcattcgcttccactcgagaaaatgtatgtgaaggaactacatgtcacaataagctctatgagattgataaacttttggag 30237229  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30237230 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30237329  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30237330 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30237385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 30281592 - 30281355
1 aattgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttgg 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||     
30281592 aattgtttcagaatgtccagtccattcgcttccactcgaaaatatatatgtgaaggaactacatgtcaccttaaggtttttgagattgataaatctttga 30281493  T
101 aggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcata 200  Q
    |||||||||| || ||| ||  |||| ||| ||||||||||||||||| ||||| || | ||| |||||||| || |||||||||||| |||  ||||||    
30281492 aggaaaccagttgaaaatttgacagattcatcatgaaaacatcgcaagcgaagagctttcactttgtagataggcccatcattaagttcaccgctgcata 30281393  T
201 acatggtgacatccttgctgttcaaaataagctcccct 238  Q
    ||||||||||||||||||  |||| |||||||||||||    
30281392 acatggtgacatccttgcaattcagaataagctcccct 30281355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 3 - 256
Target Start/End: Complemental strand, 30070118 - 30069865
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||| | |||||||||||||  ||||||||||||| || || | || |||| |||||||||||| ||||||||||| |||||||||||||||||| |     
30070118 ttgttttataatgtccagtgcaaacgcttccactcgagaaaatctctgagaaggaactacatgtcaacttaaggttttcgagattgataaacctttgcaa 30070019  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    |||||| |||||||||||  |||||||  ||||||||||||| | |  ||||  | | || | ||| |||||||||||||||||||||||||||| ||||    
30070018 gaaacctgatggaaacttgacagactcgtcatgaaaacatcgtaggcaaagagatttcaccgcgtaaataagctcatcattaagttgaccattgcgtaac 30069919  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctat 256  Q
    |||| ||||||||||| | ||| ||||||||||| | |||| ||||||||||||    
30069918 atggagacatccttgcagctcagaataagctcccttgtgttctggacaacctat 30069865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 49 - 258
Target Start/End: Complemental strand, 30253973 - 30253764
49 tgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaag 148  Q
    ||||||| ||||||| || | ||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||  |||||||||||| | |    
30253973 tgtgaaggaactacaagttatcttaaggtttttgagattgataaacctttggaggaaacctgatggaaatttgtcagactcattatgaaaacatcgtagg 30253874  T
149 tgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaataagctcccctttgttgtgga 248  Q
     ||||| || |||| ||||||||   |||||  ||| ||||||||||||||||||| ||||||||||| ||||| | ||||||||||| | |||||  ||    
30253873 cgaagagcttttaccgtgtagattgtctcattgttatgttgaccattgcataacattgtgacatccttactgtttagaataagctcccttgtgttggaga 30253774  T
249 caacctatga 258  Q
30253773 caacctatga 30253764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 3 - 236
Target Start/End: Complemental strand, 30792636 - 30792403
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||| |||||||   |||||||||| | || || | || |||| ||||||||| ||||||||| | ||  || | |||||| ||||||||    
30792636 ttgtttcagaatgttcagtgcaaatgcttccactcaagaaaatctctgagaaggaactacatgacaccttaagatattccaggtggataaatctttggag 30792537  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| ||||||| |    ||||||||||||| | | ||||| || ||||||||||||| |||||||||||||||||||| |||||||||    
30792536 gaaaccagatggaaatttttcagtcgtgtcatgaaaacatcgtaggcgaagagcttttactgtgtagatcagctcatcattaagttgaccgttgcataac 30792437  T
203 atggtgacatccttgctgttcaaaataagctccc 236  Q
    |||||||| |||||||  |||| |||||||||||    
30792436 atggtgacgtccttgcaattcagaataagctccc 30792403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 57 - 255
Target Start/End: Complemental strand, 30176838 - 30176640
57 aactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatc 156  Q
    ||||||| | ||| ||||| ||||  ||||||||||| |||||||||||||||| ||||||||| ||||||||  |||||||||||||||   ||||| |    
30176838 aactacaagacactttaagattttcaagattgataaatctttggaggaaaccagttggaaacttctcagactcgtcatgaaaacatcgcagacgaagagc 30176739  T
157 tgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaataagctcccctttgttgtggacaaccta 255  Q
    | | ||||||||||||  ||| | ||||||||||||  | ||||||||||||||||||||||  |||| ||||||||||| | |||||  |||||||||    
30176738 tttcactgtgtagatagactcgttattaagttgaccgctacataacatggtgacatccttgcaattcagaataagctcccttgtgttggtgacaaccta 30176640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 3 - 165
Target Start/End: Complemental strand, 30031978 - 30031816
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    ||||||| ||||||||||||     ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||    
30031978 ttgtttccgaatgtccagtgtcaaagcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggag 30031879  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgt 165  Q
    ||| |   |||||||  |||||||||||   |||||||| |||||| |||||||| |||||||    
30031878 gaagctgtatggaaatatttcagactcattgtgaaaacaacgcaagcgaagatcttttactgt 30031816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 3 - 165
Target Start/End: Complemental strand, 30226116 - 30225954
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    ||||||| ||||||||||||     ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||    
30226116 ttgtttccgaatgtccagtgtcaaagcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggag 30226017  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgt 165  Q
    ||| |   |||||||  |||||||||||   |||||||| |||||| |||||||| |||||||    
30226016 gaagctgtatggaaatatttcagactcattgtgaaaacaacgcaagcgaagatcttttactgt 30225954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 28 - 236
Target Start/End: Complemental strand, 30092649 - 30092441
28 gcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagac 127  Q
    ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||||| |    ||||||  ||||||||    
30092649 gcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggaggaagctgtgtggaaatatttcagac 30092550  T
128 tcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaa 227  Q
    |||   |||||||| |||||| |||||||| ||||||| |||||  ||   | ||||| |||||  || |||||||| || |||||| | | ||||| ||    
30092549 tcattgtgaaaacaacgcaagcgaagatcttttactgtatagatcggcctgtgattaaattgactgttccataacatagtaacatcccttccgttcagaa 30092450  T
228 taagctccc 236  Q
30092449 taagctccc 30092441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 28 - 236
Target Start/End: Complemental strand, 30114502 - 30114294
28 gcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagac 127  Q
    ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||||| |    ||||||  ||||||||    
30114502 gcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggaggaagctgtgtggaaatatttcagac 30114403  T
128 tcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaa 227  Q
    |||   |||||||| |||||| |||||||| ||||||| |||||  ||   | ||||| |||||  || |||||||| || |||||| | | ||||| ||    
30114402 tcattgtgaaaacaacgcaagcgaagatcttttactgtatagatcggcctgtgattaaattgactgttccataacatagtaacatcccttccgttcagaa 30114303  T
228 taagctccc 236  Q
30114302 taagctccc 30114294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 28 - 236
Target Start/End: Complemental strand, 30129254 - 30129046
28 gcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagac 127  Q
    ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||||| |    ||||||  ||||||||    
30129254 gcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggaggaagctgtgtggaaatatttcagac 30129155  T
128 tcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaa 227  Q
    |||   |||||||| |||||| |||||||| ||||||| |||||  ||   | ||||| |||||  || |||||||| || |||||| | | ||||| ||    
30129154 tcattgtgaaaacaacgcaagcgaagatcttttactgtatagatcggcctgtgattaaattgactgttccataacatagtaacatcccttccgttcagaa 30129055  T
228 taagctccc 236  Q
30129054 taagctccc 30129046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 116096 times since January 2019
Visitors: 1394