View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_27 (Length: 232)

Name: NF0538_high_27
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_high_27
[»] scaffold0172 (1 HSPs)
scaffold0172 (1-211)||(8478-8689)

Alignment Details
Target: scaffold0172 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: scaffold0172

Target: scaffold0172; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 8478 - 8689
1 tggtttatcccctaatgaaggcgaattcgattgttctgtgct-cctccacaaggtttcatgggtgatggcttagaagtttggccatttgcagaatgcaca 99  Q
    ||||||||||||||||||||||||||||||||||| || | | ||| ||||||||||||||||||| |||||||||||||||||||||| |||||| |||    
8478 tggtttatcccctaatgaaggcgaattcgattgttttgcgattcctgcacaaggtttcatgggtgacggcttagaagtttggccatttgaagaatggaca 8577  T
100 tcagtaatctttccatttgactgtcctccatgactgttagaagttgctttctttacttcagaatgcaacggactcttcttagcgaatcttttgaaagtta 199  Q
8578 tcagtaatctttccatttgactgtcctccatgactgttagaagttgctttctttacttcagaatgcaacggactcttcttagcgaatcttttgaaagtta 8677  T
200 tcggctgatcat 211  Q
8678 tcggctgatcat 8689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191857 times since January 2019
Visitors: 2831