View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_high_3 (Length: 445)

Name: NF0538_high_3
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_high_3
NF0538_high_3
[»] chr8 (1 HSPs)
chr8 (11-416)||(34430019-34430424)


Alignment Details
Target: chr8 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 11 - 416
Target Start/End: Complemental strand, 34430424 - 34430019
Alignment:
11 cagagataacagacagaaattcttcattcaagaatcgctctggtgaaacaaaaagcacctgtatgaattataattgcaatcagtatctttcacgtgagag 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34430424 cagagataacagacagaaattcttcattcaagaatcgctctggtgaaacaaaaagcacctgtatgaattataattgcaatcagtatctttcacgtgagag 34430325  T
111 ttctaacatcatcgatacagtaaattaacttgcaattcaaatgtgatatgtgaaaatggcttataaataatcaacattcacatgcatgcaatcaatcagc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34430324 ttctaacatcatcgatacagtaaattaacttgcaattcaaatgtgatatgtgaaaatggcttataaataatcaacattcacatgcatgcaatcaatcagc 34430225  T
211 aagattgctacatatatctacaaaagaagatccaagccaaagttgaactcagttgtcgaaattctcacctttattgtgccttgacgaagctggttaagcg 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34430224 aagattgctacatatatctacaaaagaagatccaagccaaagttgaactcagttgtcgaaattctcacctttattgtgccttgacgaagctggttaagcg 34430125  T
311 tttcagaggattcttcaaatgtctaatacaataaacaaaaaatgagaaagatttgtaactaaatgatctatcattagaaataattcacataaaagaccgt 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||    
34430124 tttcagaggattcttcaaatgtctaatacaataaacaaaaaatgagaaagaattgtaactaaatgatctatcattagacataattcacataaaagaccgt 34430025  T
411 aaaatc 416  Q
    ||||||    
34430024 aaaatc 34430019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175803 times since January 2019
Visitors: 2679