View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_12 (Length: 445)

Name: NF0538_low_12
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_low_12
[»] chr8 (1 HSPs)
chr8 (11-416)||(34430019-34430424)

Alignment Details
Target: chr8 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 11 - 416
Target Start/End: Complemental strand, 34430424 - 34430019
11 cagagataacagacagaaattcttcattcaagaatcgctctggtgaaacaaaaagcacctgtatgaattataattgcaatcagtatctttcacgtgagag 110  Q
34430424 cagagataacagacagaaattcttcattcaagaatcgctctggtgaaacaaaaagcacctgtatgaattataattgcaatcagtatctttcacgtgagag 34430325  T
111 ttctaacatcatcgatacagtaaattaacttgcaattcaaatgtgatatgtgaaaatggcttataaataatcaacattcacatgcatgcaatcaatcagc 210  Q
34430324 ttctaacatcatcgatacagtaaattaacttgcaattcaaatgtgatatgtgaaaatggcttataaataatcaacattcacatgcatgcaatcaatcagc 34430225  T
211 aagattgctacatatatctacaaaagaagatccaagccaaagttgaactcagttgtcgaaattctcacctttattgtgccttgacgaagctggttaagcg 310  Q
34430224 aagattgctacatatatctacaaaagaagatccaagccaaagttgaactcagttgtcgaaattctcacctttattgtgccttgacgaagctggttaagcg 34430125  T
311 tttcagaggattcttcaaatgtctaatacaataaacaaaaaatgagaaagatttgtaactaaatgatctatcattagaaataattcacataaaagaccgt 410  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||    
34430124 tttcagaggattcttcaaatgtctaatacaataaacaaaaaatgagaaagaattgtaactaaatgatctatcattagacataattcacataaaagaccgt 34430025  T
411 aaaatc 416  Q
34430024 aaaatc 34430019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191874 times since January 2019
Visitors: 2831