View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_20 (Length: 400)

Name: NF0538_low_20
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_low_20
[»] chr1 (1 HSPs)
chr1 (10-394)||(37176653-37177041)

Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 10 - 394
Target Start/End: Complemental strand, 37177041 - 37176653
10 attattctctttgctccaaattccaactaaacaacaa----cacatcgatgattctctctcattaatccatttcaacacttcaattattattactaagaa 105  Q
    |||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37177041 attattctctttgctccaaattccaactaaacaacaaacaacacatcgatgattctctctcattaatccatttcaacacttcaattattattactaagaa 37176942  T
106 tcatgttnnnnnnnnnnnnngttgtccacttcaactaatcttccgcacctagaaatgagttaatagtaacatctgactaaatttctttgacga----act 201  Q
    |||||||             |||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||    |||    
37176941 tcatgtttctctctct----gttgtccacttcaactaaccttccgcacctaaaaattagttaatagtaacatctgactaaatttctttgacgatcgaact 37176846  T
202 gagacccgatgtcggagaattctgaaatatctccgagcatgtcttcaacaagtctcggagatataccagaaatctccgcaatacatctaggaatcgatct 301  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37176845 gagatccgatgtcggagaattctgaaatatctccgagcatgtcttcaacaagtctcggagatataccagaaatctccgcaatacatctaggaatcgatct 37176746  T
302 cgtatcagcagccaaacgaaacatcacgttcttgaaaagtgttgcagattctcaatggcttcaccatacaaacattacagttgaagcaatacg 394  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37176745 cgtatcagcagccaaacgtaacatcacgttcttgaaaagtgttgcagattctcaatggcttcaccatacaaacattacagttgaagcaatacg 37176653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 31173 times since January 2019
Visitors: 1588