View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_20 (Length: 400)

Name: NF0538_low_20
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_20
NF0538_low_20
[»] chr1 (1 HSPs)
chr1 (10-394)||(37176653-37177041)


Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 10 - 394
Target Start/End: Complemental strand, 37177041 - 37176653
Alignment:
10 attattctctttgctccaaattccaactaaacaacaa----cacatcgatgattctctctcattaatccatttcaacacttcaattattattactaagaa 105  Q
    |||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37177041 attattctctttgctccaaattccaactaaacaacaaacaacacatcgatgattctctctcattaatccatttcaacacttcaattattattactaagaa 37176942  T
106 tcatgttnnnnnnnnnnnnngttgtccacttcaactaatcttccgcacctagaaatgagttaatagtaacatctgactaaatttctttgacga----act 201  Q
    |||||||             |||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||    |||    
37176941 tcatgtttctctctct----gttgtccacttcaactaaccttccgcacctaaaaattagttaatagtaacatctgactaaatttctttgacgatcgaact 37176846  T
202 gagacccgatgtcggagaattctgaaatatctccgagcatgtcttcaacaagtctcggagatataccagaaatctccgcaatacatctaggaatcgatct 301  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37176845 gagatccgatgtcggagaattctgaaatatctccgagcatgtcttcaacaagtctcggagatataccagaaatctccgcaatacatctaggaatcgatct 37176746  T
302 cgtatcagcagccaaacgaaacatcacgttcttgaaaagtgttgcagattctcaatggcttcaccatacaaacattacagttgaagcaatacg 394  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37176745 cgtatcagcagccaaacgtaacatcacgttcttgaaaagtgttgcagattctcaatggcttcaccatacaaacattacagttgaagcaatacg 37176653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199086 times since January 2019
Visitors: 2774