View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_23 (Length: 373)

Name: NF0538_low_23
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_low_23
[»] chr5 (1 HSPs)
chr5 (1-343)||(2946744-2947086)

Alignment Details
Target: chr5 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 2947086 - 2946744
1 tctcattttctttccatcttttcaaagctagttgcttcaaagaatctcaaaaagtaatgtagttagcttctttagcaagtactataaataaacattcaag 100  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
2947086 tctcattttctttccatcttttcaaagttagttgcttcaaagaatctcaaaaagtaatgtagttagcttctttagcaagtactataaataaacatttaag 2946987  T
101 taacttagatgctagtctatcatgtccattcttttacaattttgtgatccaaaaagaaatggtctacagggaatggaaccgagtggtgctaccaaacatt 200  Q
2946986 taacttagatgctagtctatcatgtccattcttttacaattttgtgatccaaaaagaaatggtctacagggaatggaaccgagtggtgctaccaaacatt 2946887  T
201 tcctggcttttggtggaggcatgagattttgtgttgggacagaatttgctaaggttcagatggcagtttttcttcattgcttggtaacaaagtataggta 300  Q
2946886 tcctggcttttggtggaggcatgagattttgtgttgggacagaatttgctaaggttcagatggcagtttttcttcattgcttggtaacaaagtataggta 2946787  T
301 ataagcaatgtcatgcatggaaagagactttaaactgaaacaa 343  Q
2946786 ataagcaatgtcatgcatggaaagagactttaaactgaaacaa 2946744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295315 times since January 2019
Visitors: 3016