View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_24 (Length: 365)

Name: NF0538_low_24
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_low_24
[»] chr4 (8 HSPs)
chr4 (1-337)||(3745708-3746044)
chr4 (1-326)||(3751536-3751861)
chr4 (93-324)||(3762517-3762748)
chr4 (84-326)||(3776596-3776838)
chr4 (1-326)||(3780909-3781234)
chr4 (1-326)||(3755403-3755728)
chr4 (116-326)||(3766931-3767141)
chr4 (28-177)||(3771310-3771459)
[»] chr7 (1 HSPs)
chr7 (7-326)||(25985288-25985604)

Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 8)
Name: chr4

Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 3746044 - 3745708
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||     
3746044 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaacacaactacttcttttggt 3745945  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
3745944 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 3745845  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3745844 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatgggagtactattactatcttggggagaaattctgctcttaataaggt 3745745  T
301 tagggaaatgcctattgttggtggtaccggacgtttt 337  Q
3745744 tagggaaatgcctattgttggtggtaccggacgtttt 3745708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 3751861 - 3751536
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    ||||||||||| ||||||||| ||| ||||||| ||||| || ||| |||||||| |||| |||| ||||||||||||||| ||||| |||| ||||||     
3751861 tttcagattctattggcatgatatcttgagtgggaaaaatcccactgcaattacaattgttccaccaccattgaagctaaacacaaccacttattttggt 3751762  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
    | |||||||||  ||||  ||||||| ||| |||||||| || ||||||||||||||||||||||||||||||| || ||||||||||||||| | ||||    
3751761 tcagtcaacatgtttgatgaccctttgactataggaccacaattgagttctaagcttgttggaaaagctcaaggtttctatgcatctgcatcacaagatg 3751662  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    | ||| ||||  ||||||||||||  ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| | |||||||||     
3751661 attttggttttctcatggctatgaactttgctttcattgaaggaaagtataatggtagtacaattactatcttggggaggaattctggtattaataaggc 3751562  T
301 tagggaaatgcctattgttggtggta 326  Q
    ||| || ||||||||| |||||||||    
3751561 tagagagatgcctattattggtggta 3751536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 93 - 324
Target Start/End: Complemental strand, 3762748 - 3762517
93 cttttgggttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatc 192  Q
    ||||||| ||||||  ||| |||||||||||||| |||||||||||  || |||||||||| |||||||||| ||||||||| || ||||||||||||||    
3762748 cttttggtttagtccgcatgattgacaaccctttgactttaggacccgaactgagttctaaacttgttggaagagctcaaggattctatgcatctgcatc 3762649  T
193 aaaggatgagtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctctt 292  Q
    | |||| ||  |  ||||  | ||| |  ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||    
3762648 acaggaagaaataggttttcttatgacagtgaattttgctttcattgaaggaaagtataatggtagtactattactatcttggggaggaatccagctctt 3762549  T
293 aataaggttagggaaatgcctattgttggtgg 324  Q
    |||||||||||||| |||||| ||||||||||    
3762548 aataaggttagggagatgcctgttgttggtgg 3762517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 84 - 326
Target Start/End: Complemental strand, 3776838 - 3776596
84 caactacttcttttgggttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgc 183  Q
    |||| |||| |||||| ||||| | ||| ||||||||||||||||||||||||||  || |||||||||| |||||||| | ||||||||| || |||||    
3776838 caaccactttttttggtttagttagcatgattgacaaccctttaactttaggacccgaattgagttctaaacttgttggtagagctcaaggattctatgc 3776739  T
184 atctgcatcaaaggatgagtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaat 283  Q
    |||||| ||| |||| ||  |  ||||  | ||| | |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||    
3776738 atctgcttcacaggaagaaataggttttcttatgacaatgaattttgctttcattgaaggaaagtataatggtagtaccattactatcttggggaggaat 3776639  T
284 tctgctcttaataaggttagggaaatgcctattgttggtggta 326  Q
      ||||| |||||||||||||||||||||| ||||||||||||    
3776638 catgctcgtaataaggttagggaaatgcctgttgttggtggta 3776596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 3781234 - 3780909
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    ||||||||||| |||||||||| || ||||||||||||| || |||||  || || || | |||| | |||  ||  ||||  |||| ||  |||||||     
3781234 tttcagattctattggcatgacgtcttgagtggaaaaaatccaacttcggttgcaattattccaccatcatcaaaagtaaactcaaccaccgcttttggt 3781135  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
    || || ||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||| || ||||||||||| ||| | || |    
3781134 ttggttaacatgattgacaaccctttaactttaggaccagaactgagttctaagcttgttggaagagctcaaggattctatgcatctgcttcacaagaag 3781035  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    |  |  ||||  | ||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||| | ||||| ||| ||||  |||||  |||    
3781034 aactaggttttcttatgacaatgaattttgctttcattgaaggaaagtataatggtagtactcttactatcgtagggaggaatcctgccattaatttggt 3780935  T
301 tagggaaatgcctattgttggtggta 326  Q
    |||||| |||||| ||||||||||||    
3780934 tagggagatgcctgttgttggtggta 3780909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 3755728 - 3755403
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    |||||||||||  ||||| |||||  ||||||||||||||||||||||| || ||||||| |||| |||| |||| |||||  |||| ||| | |||||     
3755728 tttcagattctactggcacgacatagtgagtggaaaaaaccctacttcagttgcagttgtcccaccaccaatgaaactaaactcaaccactgcctttggt 3755629  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
    | ||||  ||| || |||||||||||||||||||||||| |  ||| ||||||| ||||||||||||||||||| || |||||||||||||  || ||||    
3755628 tcagtccgcatgatcgacaaccctttaactttaggaccacagttgaattctaagattgttggaaaagctcaaggattctatgcatctgcatgcaaagatg 3755529  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    |  ||  |||| | |||||||||| ||||||||| | |||||||||||||||||| |||||  ||||||| ||||| || ||| ||| | || |||| ||    
3755528 aagttgatttgcttatggctatgaattttgcttttactgaaggaaagtataatggaagtacacttactatattgggaaggaatgctgtttttcataaagt 3755429  T
301 tagggaaatgcctattgttggtggta 326  Q
    ||| || |||||| |  |||||||||    
3755428 tagagagatgcctgtgattggtggta 3755403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 116 - 326
Target Start/End: Complemental strand, 3767141 - 3766931
116 gacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatgagtttagtttgttca 215  Q
    |||||||||||||||||||||||| |  ||| ||||||| ||||||||||||||||||| || |||||||||||||  || |||||  ||  |||| | |    
3767141 gacaaccctttaactttaggaccacagttgaattctaagattgttggaaaagctcaaggattctatgcatctgcatgcaaagatgaagttgatttgctta 3767042  T
216 tggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggttagggaaatgcctat 315  Q
    ||||||||| ||||||||| | |||||||||||||||||| |||||  ||||||| ||||| || ||| ||| | || |||| ||||| || |||||| |    
3767041 tggctatgaattttgcttttactgaaggaaagtataatggaagtacacttactatattgggaaggaatgctgtttttcataaagttagagagatgcctgt 3766942  T
316 tgttggtggta 326  Q
3766941 gattggtggta 3766931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 28 - 177
Target Start/End: Complemental strand, 3771459 - 3771310
28 gagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttgggttagtcaacattattgacaacccttta 127  Q
    |||||||||||||||| ||||  | | | |||| |||| |||| |||| ||||| ||||| ||| ||||||| | ||||  ||| || ||||||||||||    
3771459 gagtggaaaaaaccctccttcggtaataattgttccaccaccaatgaaactaaacacaaccactgcttttggttcagtccgcatgatcgacaacccttta 3771360  T
128 actttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggtt 177  Q
    |||||||||||| || ||||||||||||||||||||||| ||||||||||    
3771359 actttaggaccagaactgagttctaagcttgttggaaaatctcaagggtt 3771310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 7 - 326
Target Start/End: Original strand, 25985288 - 25985604
7 attcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttgggttagtc 106  Q
    ||||| ||||||||||||  | |||||||| |||||| |||||||  || |||| |||| ||| |||||   |||  |||| ||| ||||||| |||||     
25985288 attctattggcatgacatagttagtggaaacaacccttcttcaataccaattgttccaccacctttgaa---aaactcaaccactgcttttggtttagtt 25985384  T
107 aacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatgagttta 206  Q
    ||||| ||||| ||||||||||| ||||||||  || ||||||| ||  | ||||||||||| ||||| || ||||| ||  ||||| |   |||| |      
25985385 aacatgattgagaaccctttaaccttaggacctcaattgagttccaaattggttggaaaagcacaaggattctatgcctcaacatcacaaagtgaggtag 25985484  T
207 gtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggttaggga 306  Q
       |  |||||||||||| ||||||| | |||||||| ||||| |||||||| || || ||||| |||||||| ||| ||| |  | |||||||||||||    
25985485 accttatcatggctatgaattttgctataattgaagggaagtacaatggtagcaccatcactattttggggaggaatcctgtttctgataaggttaggga 25985584  T
307 aatgcctattgttggtggta 326  Q
    |||||||||  |||||||||    
25985585 aatgcctataattggtggta 25985604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 318582 times since January 2019
Visitors: 3039