View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_24 (Length: 365)

Name: NF0538_low_24
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_24
NF0538_low_24
[»] chr4 (8 HSPs)
chr4 (1-337)||(3745708-3746044)
chr4 (1-326)||(3751536-3751861)
chr4 (93-324)||(3762517-3762748)
chr4 (84-326)||(3776596-3776838)
chr4 (1-326)||(3780909-3781234)
chr4 (1-326)||(3755403-3755728)
chr4 (116-326)||(3766931-3767141)
chr4 (28-177)||(3771310-3771459)
[»] chr7 (1 HSPs)
chr7 (7-326)||(25985288-25985604)


Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 8)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 337
Target Start/End: Complemental strand, 3746044 - 3745708
Alignment:
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||     
3746044 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaacacaactacttcttttggt 3745945  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3745944 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 3745845  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
3745844 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatgggagtactattactatcttggggagaaattctgctcttaataaggt 3745745  T
301 tagggaaatgcctattgttggtggtaccggacgtttt 337  Q
    |||||||||||||||||||||||||||||||||||||    
3745744 tagggaaatgcctattgttggtggtaccggacgtttt 3745708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 3751861 - 3751536
Alignment:
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    ||||||||||| ||||||||| ||| ||||||| ||||| || ||| |||||||| |||| |||| ||||||||||||||| ||||| |||| ||||||     
3751861 tttcagattctattggcatgatatcttgagtgggaaaaatcccactgcaattacaattgttccaccaccattgaagctaaacacaaccacttattttggt 3751762  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
    | |||||||||  ||||  ||||||| ||| |||||||| || ||||||||||||||||||||||||||||||| || ||||||||||||||| | ||||    
3751761 tcagtcaacatgtttgatgaccctttgactataggaccacaattgagttctaagcttgttggaaaagctcaaggtttctatgcatctgcatcacaagatg 3751662  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    | ||| ||||  ||||||||||||  ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| | |||||||||     
3751661 attttggttttctcatggctatgaactttgctttcattgaaggaaagtataatggtagtacaattactatcttggggaggaattctggtattaataaggc 3751562  T
301 tagggaaatgcctattgttggtggta 326  Q
    ||| || ||||||||| |||||||||    
3751561 tagagagatgcctattattggtggta 3751536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 93 - 324
Target Start/End: Complemental strand, 3762748 - 3762517
Alignment:
93 cttttgggttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatc 192  Q
    ||||||| ||||||  ||| |||||||||||||| |||||||||||  || |||||||||| |||||||||| ||||||||| || ||||||||||||||    
3762748 cttttggtttagtccgcatgattgacaaccctttgactttaggacccgaactgagttctaaacttgttggaagagctcaaggattctatgcatctgcatc 3762649  T
193 aaaggatgagtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctctt 292  Q
    | |||| ||  |  ||||  | ||| |  ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||    
3762648 acaggaagaaataggttttcttatgacagtgaattttgctttcattgaaggaaagtataatggtagtactattactatcttggggaggaatccagctctt 3762549  T
293 aataaggttagggaaatgcctattgttggtgg 324  Q
    |||||||||||||| |||||| ||||||||||    
3762548 aataaggttagggagatgcctgttgttggtgg 3762517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 84 - 326
Target Start/End: Complemental strand, 3776838 - 3776596
Alignment:
84 caactacttcttttgggttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgc 183  Q
    |||| |||| |||||| ||||| | ||| ||||||||||||||||||||||||||  || |||||||||| |||||||| | ||||||||| || |||||    
3776838 caaccactttttttggtttagttagcatgattgacaaccctttaactttaggacccgaattgagttctaaacttgttggtagagctcaaggattctatgc 3776739  T
184 atctgcatcaaaggatgagtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaat 283  Q
    |||||| ||| |||| ||  |  ||||  | ||| | |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||    
3776738 atctgcttcacaggaagaaataggttttcttatgacaatgaattttgctttcattgaaggaaagtataatggtagtaccattactatcttggggaggaat 3776639  T
284 tctgctcttaataaggttagggaaatgcctattgttggtggta 326  Q
      ||||| |||||||||||||||||||||| ||||||||||||    
3776638 catgctcgtaataaggttagggaaatgcctgttgttggtggta 3776596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 3781234 - 3780909
Alignment:
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    ||||||||||| |||||||||| || ||||||||||||| || |||||  || || || | |||| | |||  ||  ||||  |||| ||  |||||||     
3781234 tttcagattctattggcatgacgtcttgagtggaaaaaatccaacttcggttgcaattattccaccatcatcaaaagtaaactcaaccaccgcttttggt 3781135  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
    || || ||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||| || ||||||||||| ||| | || |    
3781134 ttggttaacatgattgacaaccctttaactttaggaccagaactgagttctaagcttgttggaagagctcaaggattctatgcatctgcttcacaagaag 3781035  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    |  |  ||||  | ||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||| | ||||| ||| ||||  |||||  |||    
3781034 aactaggttttcttatgacaatgaattttgctttcattgaaggaaagtataatggtagtactcttactatcgtagggaggaatcctgccattaatttggt 3780935  T
301 tagggaaatgcctattgttggtggta 326  Q
    |||||| |||||| ||||||||||||    
3780934 tagggagatgcctgttgttggtggta 3780909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 3755728 - 3755403
Alignment:
1 tttcagattcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttggg 100  Q
    |||||||||||  ||||| |||||  ||||||||||||||||||||||| || ||||||| |||| |||| |||| |||||  |||| ||| | |||||     
3755728 tttcagattctactggcacgacatagtgagtggaaaaaaccctacttcagttgcagttgtcccaccaccaatgaaactaaactcaaccactgcctttggt 3755629  T
101 ttagtcaacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatg 200  Q
    | ||||  ||| || |||||||||||||||||||||||| |  ||| ||||||| ||||||||||||||||||| || |||||||||||||  || ||||    
3755628 tcagtccgcatgatcgacaaccctttaactttaggaccacagttgaattctaagattgttggaaaagctcaaggattctatgcatctgcatgcaaagatg 3755529  T
201 agtttagtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggt 300  Q
    |  ||  |||| | |||||||||| ||||||||| | |||||||||||||||||| |||||  ||||||| ||||| || ||| ||| | || |||| ||    
3755528 aagttgatttgcttatggctatgaattttgcttttactgaaggaaagtataatggaagtacacttactatattgggaaggaatgctgtttttcataaagt 3755429  T
301 tagggaaatgcctattgttggtggta 326  Q
    ||| || |||||| |  |||||||||    
3755428 tagagagatgcctgtgattggtggta 3755403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 116 - 326
Target Start/End: Complemental strand, 3767141 - 3766931
Alignment:
116 gacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatgagtttagtttgttca 215  Q
    |||||||||||||||||||||||| |  ||| ||||||| ||||||||||||||||||| || |||||||||||||  || |||||  ||  |||| | |    
3767141 gacaaccctttaactttaggaccacagttgaattctaagattgttggaaaagctcaaggattctatgcatctgcatgcaaagatgaagttgatttgctta 3767042  T
216 tggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggttagggaaatgcctat 315  Q
    ||||||||| ||||||||| | |||||||||||||||||| |||||  ||||||| ||||| || ||| ||| | || |||| ||||| || |||||| |    
3767041 tggctatgaattttgcttttactgaaggaaagtataatggaagtacacttactatattgggaaggaatgctgtttttcataaagttagagagatgcctgt 3766942  T
316 tgttggtggta 326  Q
      |||||||||    
3766941 gattggtggta 3766931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 28 - 177
Target Start/End: Complemental strand, 3771459 - 3771310
Alignment:
28 gagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttgggttagtcaacattattgacaacccttta 127  Q
    |||||||||||||||| ||||  | | | |||| |||| |||| |||| ||||| ||||| ||| ||||||| | ||||  ||| || ||||||||||||    
3771459 gagtggaaaaaaccctccttcggtaataattgttccaccaccaatgaaactaaacacaaccactgcttttggttcagtccgcatgatcgacaacccttta 3771360  T
128 actttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggtt 177  Q
    |||||||||||| || ||||||||||||||||||||||| ||||||||||    
3771359 actttaggaccagaactgagttctaagcttgttggaaaatctcaagggtt 3771310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 7 - 326
Target Start/End: Original strand, 25985288 - 25985604
Alignment:
7 attcttttggcatgacatcatgagtggaaaaaaccctacttcaattacagttgtaccactaccattgaagctaaatacaactacttcttttgggttagtc 106  Q
    ||||| ||||||||||||  | |||||||| |||||| |||||||  || |||| |||| ||| |||||   |||  |||| ||| ||||||| |||||     
25985288 attctattggcatgacatagttagtggaaacaacccttcttcaataccaattgttccaccacctttgaa---aaactcaaccactgcttttggtttagtt 25985384  T
107 aacattattgacaaccctttaactttaggaccaaaaatgagttctaagcttgttggaaaagctcaagggttgtatgcatctgcatcaaaggatgagttta 206  Q
    ||||| ||||| ||||||||||| ||||||||  || ||||||| ||  | ||||||||||| ||||| || ||||| ||  ||||| |   |||| |      
25985385 aacatgattgagaaccctttaaccttaggacctcaattgagttccaaattggttggaaaagcacaaggattctatgcctcaacatcacaaagtgaggtag 25985484  T
207 gtttgttcatggctatgacttttgctttcattgaaggaaagtataatggtagtactattactatcttggggagaaattctgctcttaataaggttaggga 306  Q
       |  |||||||||||| ||||||| | |||||||| ||||| |||||||| || || ||||| |||||||| ||| ||| |  | |||||||||||||    
25985485 accttatcatggctatgaattttgctataattgaagggaagtacaatggtagcaccatcactattttggggaggaatcctgtttctgataaggttaggga 25985584  T
307 aatgcctattgttggtggta 326  Q
    |||||||||  |||||||||    
25985585 aatgcctataattggtggta 25985604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125345 times since January 2019
Visitors: 1457