View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_32 (Length: 329)

Name: NF0538_low_32
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_low_32
[»] chr4 (2 HSPs)
chr4 (1-301)||(10187472-10187772)
chr4 (42-220)||(28933230-28933407)
[»] chr2 (1 HSPs)
chr2 (129-280)||(35120580-35120731)

Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 10187472 - 10187772
1 ccgagatgtacgttctactcctgtggtttttattctacttttttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaa 100  Q
10187472 ccgagatgtacgttctactcctgtggtttttattctacttttttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaa 10187571  T
101 aaatgttggtgttctgtgcgctaatccatggtcgtggttagagaaagttaatttttcgtctatcttctgaatcaccttttattggcttggtattttacat 200  Q
10187572 aaatgttggtgttctgtgcgctaatccatggtcgtggttagagaaagttaatttttcgtctatcttctgaatcaccttttattggcttggtattttacat 10187671  T
201 gtttaatgaaattggcagatagtagataacgtgctggatataattgacagaattgacaaccccattattgataaaatacaaaggtatgtttcacaggttc 300  Q
    ||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||    
10187672 gtttaatgaaactggcagatagtagatgacgtgcgggatataattgacagaattgacaaccccattattgataaaatacaaaggtatgtttctcagtttc 10187771  T
301 t 301  Q
10187772 t 10187772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 42 - 220
Target Start/End: Original strand, 28933230 - 28933407
42 tttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaaaaatgttggtgttctgtgcgctaatccatggtcgtggttag 141  Q
    ||||| ||||||||||||||| ||||| | |||||||| ||| |||| || ||| |||||||| |||||||| |||||  |||| |||| | |||| |||    
28933230 tttctacctgcattttgttctatattatgtattctgcaggtttcctcaggccccataaaaaatattggtgttgtgtgc--taattcatgattgtggatag 28933327  T
142 agaaagttaatttt-tcgtctatcttctgaatcaccttttattggcttggtattttacatgtttaatgaaattggcagat 220  Q
    | ||  || ||||| || |||| |||  |||||||||||||||||| ||||||||||||||| |||||||||||||||||    
28933328 aaaatttttattttgtcatctaactttcgaatcaccttttattggcctggtattttacatgtctaatgaaattggcagat 28933407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 280
Target Start/End: Complemental strand, 35120731 - 35120580
129 tggtcgtggttagagaaagttaatttttcgtctatcttctgaatcaccttttattggcttggtattttacatgtttaatgaaattggcagatagtagata 228  Q
    ||||| ||| |||||||| |  ||||||| |||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||     
35120731 tggtcatggatagagaaaatatatttttcatctaacttctgaatcacctttttttggcttggtattttacatttttaatgaaattggcagatggtagatg 35120632  T
229 acgtgctggatataattgacagaattgacaaccccattattgataaaataca 280  Q
    || ||| ||||| |||||| | || |||||||||||||||| | ||||||||    
35120631 acttgcgggatagaattgaaacaagtgacaaccccattattaacaaaataca 35120580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 217110 times since January 2019
Visitors: 2908