View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_32 (Length: 329)

Name: NF0538_low_32
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_32
NF0538_low_32
[»] chr4 (2 HSPs)
chr4 (1-301)||(10187472-10187772)
chr4 (42-220)||(28933230-28933407)
[»] chr2 (1 HSPs)
chr2 (129-280)||(35120580-35120731)


Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 10187472 - 10187772
Alignment:
1 ccgagatgtacgttctactcctgtggtttttattctacttttttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10187472 ccgagatgtacgttctactcctgtggtttttattctacttttttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaa 10187571  T
101 aaatgttggtgttctgtgcgctaatccatggtcgtggttagagaaagttaatttttcgtctatcttctgaatcaccttttattggcttggtattttacat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10187572 aaatgttggtgttctgtgcgctaatccatggtcgtggttagagaaagttaatttttcgtctatcttctgaatcaccttttattggcttggtattttacat 10187671  T
201 gtttaatgaaattggcagatagtagataacgtgctggatataattgacagaattgacaaccccattattgataaaatacaaaggtatgtttcacaggttc 300  Q
    ||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||    
10187672 gtttaatgaaactggcagatagtagatgacgtgcgggatataattgacagaattgacaaccccattattgataaaatacaaaggtatgtttctcagtttc 10187771  T
301 t 301  Q
    |    
10187772 t 10187772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 42 - 220
Target Start/End: Original strand, 28933230 - 28933407
Alignment:
42 tttctgcctgcattttgttctttattaagcattctgcatgttgcctcggggcccttaaaaaatgttggtgttctgtgcgctaatccatggtcgtggttag 141  Q
    ||||| ||||||||||||||| ||||| | |||||||| ||| |||| || ||| |||||||| |||||||| |||||  |||| |||| | |||| |||    
28933230 tttctacctgcattttgttctatattatgtattctgcaggtttcctcaggccccataaaaaatattggtgttgtgtgc--taattcatgattgtggatag 28933327  T
142 agaaagttaatttt-tcgtctatcttctgaatcaccttttattggcttggtattttacatgtttaatgaaattggcagat 220  Q
    | ||  || ||||| || |||| |||  |||||||||||||||||| ||||||||||||||| |||||||||||||||||    
28933328 aaaatttttattttgtcatctaactttcgaatcaccttttattggcctggtattttacatgtctaatgaaattggcagat 28933407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 280
Target Start/End: Complemental strand, 35120731 - 35120580
Alignment:
129 tggtcgtggttagagaaagttaatttttcgtctatcttctgaatcaccttttattggcttggtattttacatgtttaatgaaattggcagatagtagata 228  Q
    ||||| ||| |||||||| |  ||||||| |||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||     
35120731 tggtcatggatagagaaaatatatttttcatctaacttctgaatcacctttttttggcttggtattttacatttttaatgaaattggcagatggtagatg 35120632  T
229 acgtgctggatataattgacagaattgacaaccccattattgataaaataca 280  Q
    || ||| ||||| |||||| | || |||||||||||||||| | ||||||||    
35120631 acttgcgggatagaattgaaacaagtgacaaccccattattaacaaaataca 35120580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111587 times since January 2019
Visitors: 1375