View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_39 (Length: 304)

Name: NF0538_low_39
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_low_39
[»] chr7 (1 HSPs)
chr7 (1-295)||(45308815-45309109)

Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 45308815 - 45309109
1 atatataatgaaaactaaaacattgctagtctcgtcctttttcctcatcttgattattaatattacttttggtattgtccacagtgataatttcaatgag 100  Q
45308815 atatataatgaaaactaaaacattgctagtctcgtcctttttcctcatcttgattattaatattacttttggtattgtccacagtgataatttcaatgag 45308914  T
101 tttagaatccctaataaggttgtcaagtccttatgcaaagacactgatgaccataaactttgccatgatgtcctctaccccgtgaaaacctcaaacccaa 200  Q
45308915 tttagaatccctaataaggttgtcaagtccttatgcaaagacactgatgaccataaactttgccatgatgtcctctaccccgtgaaaacctcaaacccaa 45309014  T
201 tagattatattgatgttgtggtgaagaacttgatggaaagcgtagaaaacgcatttaatgacatgagtaataaacttagttctatggagaataat 295  Q
45309015 tagattatattgatgttgtggtgaagaacttgatggaaagcgtagaaaacgcatttaatgacatgagtaataaacttagttctatggagaataat 45309109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 192048 times since January 2019
Visitors: 2831