View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_39 (Length: 304)

Name: NF0538_low_39
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_39
NF0538_low_39
[»] chr7 (1 HSPs)
chr7 (1-295)||(45308815-45309109)


Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 45308815 - 45309109
Alignment:
1 atatataatgaaaactaaaacattgctagtctcgtcctttttcctcatcttgattattaatattacttttggtattgtccacagtgataatttcaatgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45308815 atatataatgaaaactaaaacattgctagtctcgtcctttttcctcatcttgattattaatattacttttggtattgtccacagtgataatttcaatgag 45308914  T
101 tttagaatccctaataaggttgtcaagtccttatgcaaagacactgatgaccataaactttgccatgatgtcctctaccccgtgaaaacctcaaacccaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45308915 tttagaatccctaataaggttgtcaagtccttatgcaaagacactgatgaccataaactttgccatgatgtcctctaccccgtgaaaacctcaaacccaa 45309014  T
201 tagattatattgatgttgtggtgaagaacttgatggaaagcgtagaaaacgcatttaatgacatgagtaataaacttagttctatggagaataat 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45309015 tagattatattgatgttgtggtgaagaacttgatggaaagcgtagaaaacgcatttaatgacatgagtaataaacttagttctatggagaataat 45309109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 116159 times since January 2019
Visitors: 1395