View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_45 (Length: 287)

Name: NF0538_low_45
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0538_low_45
[»] chr1 (1 HSPs)
chr1 (1-264)||(43469916-43470179)
[»] chr8 (2 HSPs)
chr8 (209-264)||(10642590-10642645)
chr8 (209-259)||(32713193-32713243)
[»] chr7 (1 HSPs)
chr7 (209-264)||(23924004-23924059)

Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 43469916 - 43470179
1 ctaagtgtgttgtttgttactttgagcatgttctccaactcaatgcacatgcattcacatgatgaattcttcttctcacatcatatacaccaaacaaaac 100  Q
43469916 ctaagtgtgttgtttgttactttgagcatgttctccaactcaatgcacatgcattcacatgatgaattcttcttctcacatcatatacaccaaacaaaac 43470015  T
101 ctctctatacaacaacctttcatcacaaacacacacctcatctaattaaaccacaccctggattattcctatacaactttccaaattcattgtatttaat 200  Q
43470016 ctctctatacaacaacctttcatcacaaacacacacctcatctaattaaaccacaccctggattattcctatacaactttccaaattcattgtatttaat 43470115  T
201 ttaattacaaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 264  Q
43470116 ttaattacaaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 43470179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 264
Target Start/End: Complemental strand, 10642645 - 10642590
209 aaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 264  Q
    |||||||||||||||| ||||| ||||||||||||||||||| || ||||||||||    
10642645 aaatccatcactctccatccagttcaataaacgtggcaacgtagcgtaaaacatgt 10642590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 209 - 259
Target Start/End: Original strand, 32713193 - 32713243
209 aaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaa 259  Q
    |||||||||||||||| ||||| ||||||||| ||||||||| || |||||    
32713193 aaatccatcactctccatccagttcaataaacatggcaacgtagcgtaaaa 32713243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 264
Target Start/End: Original strand, 23924004 - 23924059
209 aaatccatcactctccttccagctcaataaacgtggcaacgtggcataaaacatgt 264  Q
    |||||||||||||||| ||||| ||||||||||||||||||| || ||||||||||    
23924004 aaatccatcactctccatccagttcaataaacgtggcaacgtagcgtaaaacatgt 23924059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125389 times since January 2019
Visitors: 1457