View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_50 (Length: 267)

Name: NF0538_low_50
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_50
NF0538_low_50
[»] chr2 (17 HSPs)
chr2 (1-258)||(30182250-30182507)
chr2 (3-258)||(30024743-30024998)
chr2 (3-258)||(30117124-30117379)
chr2 (3-258)||(30131881-30132136)
chr2 (3-258)||(30035699-30035954)
chr2 (3-258)||(30229837-30230092)
chr2 (3-258)||(30237130-30237385)
chr2 (1-238)||(30281355-30281592)
chr2 (3-256)||(30069865-30070118)
chr2 (49-258)||(30253764-30253973)
chr2 (3-236)||(30792403-30792636)
chr2 (57-255)||(30176640-30176838)
chr2 (3-165)||(30031816-30031978)
chr2 (3-165)||(30225954-30226116)
chr2 (28-236)||(30092441-30092649)
chr2 (28-236)||(30114294-30114502)
chr2 (28-236)||(30129046-30129254)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 17)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 30182250 - 30182507
Alignment:
1 aattgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttgg 100  Q
    |||||||||||||||||  ||||||||||||||| | | |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||    
30182250 aattgtttcagaatgtctggtgcattcgcttccatttgcaaatatatatgtgaaggaactacatgtcaccttaaggtttttgagattgatgaacctttgg 30182349  T
101 aggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcata 200  Q
    ||||||||||||||||||||||||||| || | |||||||||||||||  |||| |||||||||||| |||||||||||||||||| ||||||||||||     
30182350 aggaaaccagatggaaacttttcagacacatcgtgaaaacatcgcaagcaaagagctgttactgtgttgataagctcatcattaaggtgaccattgcatg 30182449  T
201 acatggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
     ||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||    
30182450 ccatggtgacatccttgctgttcagaataagctcccctttgttttggacaatctatga 30182507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 258
Target Start/End: Complemental strand, 30024998 - 30024743
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| ||||| |||||||||||| || || ||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||||    
30024998 ttgtttcagaatgtccagcgcatttgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagctttatgagattgataaacttttggag 30024899  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30024898 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30024799  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30024798 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30024743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30117124 - 30117379
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| ||||| |||||||||||| || || ||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||||    
30117124 ttgtttcagaatgtccagcgcatttgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagctttatgagattgataaacttttggag 30117223  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30117224 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30117323  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30117324 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30117379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30131881 - 30132136
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| ||||| |||||||||||| || || ||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||||    
30131881 ttgtttcagaatgtccagcgcatttgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagctttatgagattgataaacttttggag 30131980  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30131981 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30132080  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30132081 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30132136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30035699 - 30035954
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| |||||||||||||||||| || || ||||||||| |||||||||||||||||||  || |||||||||||||| |||||||    
30035699 ttgtttcagaatgtccagcgcattcgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagcattatgagattgataaacttttggag 30035798  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| |||||||||||||| |||||||||||||||||||||||    
30035799 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcaccattaagttgaccattgcataac 30035898  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30035899 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30035954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30229837 - 30230092
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| |||||||||||||||||| || || ||||||||| |||||||||||||||||||  || |||||||||||||| |||||||    
30229837 ttgtttcagaatgtccagcgcattcgcttccactcgagaaaatgtatgtgaaggaactacatgtcaccttaagcattatgagattgataaacttttggag 30229936  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| |||||||||||||| |||||||||||||||||||||||    
30229937 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcaccattaagttgaccattgcataac 30230036  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30230037 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30230092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 30237130 - 30237385
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||||||| |||||||||||||||||| || || ||||||||| |||||||||||||  |||| | | |||||||||||||| |||||||    
30237130 ttgtttcagaatgtccagcgcattcgcttccactcgagaaaatgtatgtgaaggaactacatgtcacaataagctctatgagattgataaacttttggag 30237229  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| || |||| |||| |||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
30237230 gaaaccagatggaaatttgtcagcctcatcatggaaacatcgcaggcgaagagctgttactctgtagataagctcatcattaagttgaccattgcataac 30237329  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctatga 258  Q
    |||||||||||||| ||||||| ||||||||||| | ||||| |||||| ||||||    
30237330 atggtgacatcctttctgttcagaataagctcccttgtgttggggacaaactatga 30237385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 30281592 - 30281355
Alignment:
1 aattgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttgg 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||     
30281592 aattgtttcagaatgtccagtccattcgcttccactcgaaaatatatatgtgaaggaactacatgtcaccttaaggtttttgagattgataaatctttga 30281493  T
101 aggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcata 200  Q
    |||||||||| || ||| ||  |||| ||| ||||||||||||||||| ||||| || | ||| |||||||| || |||||||||||| |||  ||||||    
30281492 aggaaaccagttgaaaatttgacagattcatcatgaaaacatcgcaagcgaagagctttcactttgtagataggcccatcattaagttcaccgctgcata 30281393  T
201 acatggtgacatccttgctgttcaaaataagctcccct 238  Q
    ||||||||||||||||||  |||| |||||||||||||    
30281392 acatggtgacatccttgcaattcagaataagctcccct 30281355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 3 - 256
Target Start/End: Complemental strand, 30070118 - 30069865
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||| | |||||||||||||  ||||||||||||| || || | || |||| |||||||||||| ||||||||||| |||||||||||||||||| |     
30070118 ttgttttataatgtccagtgcaaacgcttccactcgagaaaatctctgagaaggaactacatgtcaacttaaggttttcgagattgataaacctttgcaa 30070019  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    |||||| |||||||||||  |||||||  ||||||||||||| | |  ||||  | | || | ||| |||||||||||||||||||||||||||| ||||    
30070018 gaaacctgatggaaacttgacagactcgtcatgaaaacatcgtaggcaaagagatttcaccgcgtaaataagctcatcattaagttgaccattgcgtaac 30069919  T
203 atggtgacatccttgctgttcaaaataagctcccctttgttgtggacaacctat 256  Q
    |||| ||||||||||| | ||| ||||||||||| | |||| ||||||||||||    
30069918 atggagacatccttgcagctcagaataagctcccttgtgttctggacaacctat 30069865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 49 - 258
Target Start/End: Complemental strand, 30253973 - 30253764
Alignment:
49 tgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaag 148  Q
    ||||||| ||||||| || | ||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||  |||||||||||| | |    
30253973 tgtgaaggaactacaagttatcttaaggtttttgagattgataaacctttggaggaaacctgatggaaatttgtcagactcattatgaaaacatcgtagg 30253874  T
149 tgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaataagctcccctttgttgtgga 248  Q
     ||||| || |||| ||||||||   |||||  ||| ||||||||||||||||||| ||||||||||| ||||| | ||||||||||| | |||||  ||    
30253873 cgaagagcttttaccgtgtagattgtctcattgttatgttgaccattgcataacattgtgacatccttactgtttagaataagctcccttgtgttggaga 30253774  T
249 caacctatga 258  Q
    ||||||||||    
30253773 caacctatga 30253764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 3 - 236
Target Start/End: Complemental strand, 30792636 - 30792403
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    |||||||||||||| |||||||   |||||||||| | || || | || |||| ||||||||| ||||||||| | ||  || | |||||| ||||||||    
30792636 ttgtttcagaatgttcagtgcaaatgcttccactcaagaaaatctctgagaaggaactacatgacaccttaagatattccaggtggataaatctttggag 30792537  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataac 202  Q
    ||||||||||||||| ||||||| |    ||||||||||||| | | ||||| || ||||||||||||| |||||||||||||||||||| |||||||||    
30792536 gaaaccagatggaaatttttcagtcgtgtcatgaaaacatcgtaggcgaagagcttttactgtgtagatcagctcatcattaagttgaccgttgcataac 30792437  T
203 atggtgacatccttgctgttcaaaataagctccc 236  Q
    |||||||| |||||||  |||| |||||||||||    
30792436 atggtgacgtccttgcaattcagaataagctccc 30792403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 57 - 255
Target Start/End: Complemental strand, 30176838 - 30176640
Alignment:
57 aactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatc 156  Q
    ||||||| | ||| ||||| ||||  ||||||||||| |||||||||||||||| ||||||||| ||||||||  |||||||||||||||   ||||| |    
30176838 aactacaagacactttaagattttcaagattgataaatctttggaggaaaccagttggaaacttctcagactcgtcatgaaaacatcgcagacgaagagc 30176739  T
157 tgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaataagctcccctttgttgtggacaaccta 255  Q
    | | ||||||||||||  ||| | ||||||||||||  | ||||||||||||||||||||||  |||| ||||||||||| | |||||  |||||||||    
30176738 tttcactgtgtagatagactcgttattaagttgaccgctacataacatggtgacatccttgcaattcagaataagctcccttgtgttggtgacaaccta 30176640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 3 - 165
Target Start/End: Complemental strand, 30031978 - 30031816
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    ||||||| ||||||||||||     ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||    
30031978 ttgtttccgaatgtccagtgtcaaagcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggag 30031879  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgt 165  Q
    ||| |   |||||||  |||||||||||   |||||||| |||||| |||||||| |||||||    
30031878 gaagctgtatggaaatatttcagactcattgtgaaaacaacgcaagcgaagatcttttactgt 30031816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 3 - 165
Target Start/End: Complemental strand, 30226116 - 30225954
Alignment:
3 ttgtttcagaatgtccagtgcattcgcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggag 102  Q
    ||||||| ||||||||||||     ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||    
30226116 ttgtttccgaatgtccagtgtcaaagcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggag 30226017  T
103 gaaaccagatggaaacttttcagactcagcatgaaaacatcgcaagtgaagatctgttactgt 165  Q
    ||| |   |||||||  |||||||||||   |||||||| |||||| |||||||| |||||||    
30226016 gaagctgtatggaaatatttcagactcattgtgaaaacaacgcaagcgaagatcttttactgt 30225954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 28 - 236
Target Start/End: Complemental strand, 30092649 - 30092441
Alignment:
28 gcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagac 127  Q
    ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||||| |    ||||||  ||||||||    
30092649 gcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggaggaagctgtgtggaaatatttcagac 30092550  T
128 tcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaa 227  Q
    |||   |||||||| |||||| |||||||| ||||||| |||||  ||   | ||||| |||||  || |||||||| || |||||| | | ||||| ||    
30092549 tcattgtgaaaacaacgcaagcgaagatcttttactgtatagatcggcctgtgattaaattgactgttccataacatagtaacatcccttccgttcagaa 30092450  T
228 taagctccc 236  Q
    |||||||||    
30092449 taagctccc 30092441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 28 - 236
Target Start/End: Complemental strand, 30114502 - 30114294
Alignment:
28 gcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagac 127  Q
    ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||||| |    ||||||  ||||||||    
30114502 gcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggaggaagctgtgtggaaatatttcagac 30114403  T
128 tcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaa 227  Q
    |||   |||||||| |||||| |||||||| ||||||| |||||  ||   | ||||| |||||  || |||||||| || |||||| | | ||||| ||    
30114402 tcattgtgaaaacaacgcaagcgaagatcttttactgtatagatcggcctgtgattaaattgactgttccataacatagtaacatcccttccgttcagaa 30114303  T
228 taagctccc 236  Q
    |||||||||    
30114302 taagctccc 30114294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 28 - 236
Target Start/End: Complemental strand, 30129254 - 30129046
Alignment:
28 gcttccactcgaaaatatatatgtgaagaaactacatgtcaccttaaggtttttgagattgataaacctttggaggaaaccagatggaaacttttcagac 127  Q
    ||||||||| || || || | ||||||| |||| || |||||| |||| ||||  ||||||||||| ||||||||||| |    ||||||  ||||||||    
30129254 gcttccacttgagaaaatttctgtgaaggaactgcaagtcaccataagtttttcaagattgataaatctttggaggaagctgtgtggaaatatttcagac 30129155  T
128 tcagcatgaaaacatcgcaagtgaagatctgttactgtgtagataagctcatcattaagttgaccattgcataacatggtgacatccttgctgttcaaaa 227  Q
    |||   |||||||| |||||| |||||||| ||||||| |||||  ||   | ||||| |||||  || |||||||| || |||||| | | ||||| ||    
30129154 tcattgtgaaaacaacgcaagcgaagatcttttactgtatagatcggcctgtgattaaattgactgttccataacatagtaacatcccttccgttcagaa 30129055  T
228 taagctccc 236  Q
    |||||||||    
30129054 taagctccc 30129046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175388 times since January 2019
Visitors: 2677