View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_53 (Length: 264)

Name: NF0538_low_53
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_53
NF0538_low_53
[»] chr5 (1 HSPs)
chr5 (1-256)||(30041979-30042234)
[»] chr7 (1 HSPs)
chr7 (182-256)||(21114686-21114761)


Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 30041979 - 30042234
Alignment:
1 ataaaaaacaacctatcttaaatcgttaatcaaccacctagcacgcttaaagccccctcacttttcatagatatccaaaatatcattaaaatcaccaagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30041979 ataaaaaacaacctatcttaaatcgttaatcaaccacctagcacgcttaaagccccctcacttttcatagatatccaaaatatcattaaaatcaccaagg 30042078  T
101 atacactattgaagcgaagtaccacaagataaatttctcaaaaaatcccaagaattgcgtcttcgactcccttataggaatccataaaaacttgtaaatg 200  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30042079 atacaccattgaagcgaagtaccacaagataaatttctcaaaaaatcccaagaattgcgtcttcgactcccttataggaatccataaaaacttgtaaatg 30042178  T
201 ccatcttccttgactaggatcatggacttcaacattaatataatttgcagaataat 256  Q
    |||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||    
30042179 ccatctcccttgactaggatcacggacttcaacattaatataattttcagaataat 30042234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 21114761 - 21114686
Alignment:
182 ccataaaaacttgtaaat-gccatcttccttgactaggatcatggacttcaacattaatataatttgcagaataat 256  Q
    |||||||||| ||||||| |||||   ||| |||||||||||| ||||||||||||||||| ||| ||||||||||    
21114761 ccataaaaacctgtaaattgccatggccctcgactaggatcattgacttcaacattaatatgattagcagaataat 21114686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176136 times since January 2019
Visitors: 2680