View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_57 (Length: 252)

Name: NF0538_low_57
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_57
NF0538_low_57
[»] chr1 (1 HSPs)
chr1 (12-252)||(43469317-43469557)


Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 43469317 - 43469557
Alignment:
12 atgaaaataaacataaccaaaaccaatattttgtgtaactataaaaccatgtttagtctttacaaatgaatgaatcactcatcagaccctgtcaatacat 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43469317 atgaaaataaacataaccaaaaccaatattttgtgtaactataaaaccatgtttagtctttacaaatgaatgaatcactcatcagaccctgtcaatacat 43469416  T
112 caaccataaccttcataacactcactctattttgcaaagacaatatgtaattagctgtctctctaaaaagtccatccaacccaatagattcatcactatt 211  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43469417 caaccataaccttcataacactcactctattttgcaaagacagtatgtaattagctgtctctctaaaaagtccatccaacccaatagattcatcactatt 43469516  T
212 tggtataagtctcttcaatgttctcacacgtctctgaattc 252  Q
    |||||||||||||||||||||||||||||||||||||||||    
43469517 tggtataagtctcttcaatgttctcacacgtctctgaattc 43469557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295305 times since January 2019
Visitors: 3016