View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_58 (Length: 251)

Name: NF0538_low_58
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_58
NF0538_low_58
[»] chr3 (1 HSPs)
chr3 (11-251)||(24790475-24790715)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 24790475 - 24790715
Alignment:
11 caaagggtcattgataatgtaccttgaattcctagtttcctcttagattgagtcctcccaggtttcttttcaccactagaaagagcaacaacaccttcaa 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
24790475 caaagggtcattgataatgtaccttgaattcctagtttcctcttagattgagacctcccaggtttcttttcaccactagaaagagcaacaacaccttcaa 24790574  T
111 gcttctctttcaaatccttcacttctaaatccttaaccttcacttcattcttcaactcctccaccaccgcttcatacggcgccacaacctccctcaccga 210  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24790575 gtttctctttcaaatccttcacttctaaatccttaaccttcacttcattcttcaactcctccaccaccgcttcatacggcgccacaacctccctcaccga 24790674  T
211 cgccacaccaaaacctcttctccgaccacctttcctgccac 251  Q
    |||||||||||||||||||||||||||||||||||||||||    
24790675 cgccacaccaaaacctcttctccgaccacctttcctgccac 24790715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295231 times since January 2019
Visitors: 3016