View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0538_low_69 (Length: 236)

Name: NF0538_low_69
Description: NF0538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0538_low_69
NF0538_low_69
[»] chr3 (1 HSPs)
chr3 (9-236)||(41849761-41849988)


Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 236
Target Start/End: Complemental strand, 41849988 - 41849761
Alignment:
9 ctctctttcatttctttctcttcattttatacctttgcttacttcatgtaaaataaccaagacattcaaatttgtttgttctgttgtagttgtaggagaa 108  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41849988 ctctatttcatttctttctcttcattttataccattgcttacttcatgtaaaataaccaagacattcaaatttgtttgttctgttgtagttgtaggagaa 41849889  T
109 gctgagttagatggaactgagaataagccaaggttacttagtctcaacaaaatcaagggtgttgcctgtggtattcttgcagcttatgctgttacttctg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41849888 gctgagttagatggaactgagaataagccaaggttacttagtctcaacaaaatcaagggtgttgcctgtggtattcttgcagcttatgctgttacttctg 41849789  T
209 cttcatttcccgtctctgctgctcctca 236  Q
    |||||||||||||  |||||||| ||||    
41849788 cttcatttcccgttactgctgctactca 41849761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 295242 times since January 2019
Visitors: 3016