View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_high_10 (Length: 228)

Name: NF0633_high_10
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0633_high_10
NF0633_high_10
[»] chr3 (1 HSPs)
chr3 (1-228)||(24830766-24830986)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 24830766 - 24830986
Alignment:
1 tcatcatgaaaaacaattaaccctcttaaaaaccttaatcaccttacacagatgcttacaacataaaattaaccagaagcctcaaaatcgcggtgcaatc 100  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||       |||||||||||| |||||||||||||||||||||||||||||||    
24830766 tcatcatgaaaaacaaataaccctcttaaaaaccttaatcaccttacac-------tacaacataaaactaaccagaagcctcaaaatcgcggtgcaatc 24830858  T
101 ggaaaccttaattaaacatttttgtctttccaatcaaccatcatcaacattcttgacactatttactgcataatatttgcttctaccctcagaaataaca 200  Q
    || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
24830859 gggaaccttaattaaacatttttgtctttccaatcaaccattatcaacattcttgacactatttactgcataatatttgcttctgccctcagaaataaca 24830958  T
201 aggactaagtcgtcacacaaatgaatca 228  Q
    ||||||||||||||||||||||||||||    
24830959 aggactaagtcgtcacacaaatgaatca 24830986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 318495 times since January 2019
Visitors: 3039