View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_high_9 (Length: 244)

Name: NF0633_high_9
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0633_high_9
NF0633_high_9
[»] chr7 (2 HSPs)
chr7 (14-244)||(14812624-14812852)
chr7 (14-244)||(15259619-15259847)
[»] chr5 (1 HSPs)
chr5 (14-244)||(17521328-17521556)


Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 244
Target Start/End: Complemental strand, 14812852 - 14812624
Alignment:
14 aggtgaaaagtttgtaaaagatccaaaaaggttaaaggatcctatgatttttgttcaagaacttttggacatgaaagattagtatgatatagtatattaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||  |||||||||    
14812852 aggtgaaaagtttgtaaaagatccaaaaaggttaaaggatcctatgatttttgttcaagaacttttggacatgaaagataaatatgata--gtatattaa 14812755  T
114 acttggcatttaatcatgatgaagaattccatggagtgctggactcatcatttgagtacattattaacttgaatcacaatttgccagagtttctttcgtc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14812754 acttggcatttaatcatgatgaagaattccatggagtgctggactcatcatttgagtacattattaacttgaatcacaatttgccagagtttctttcgtc 14812655  T
214 gttcttggatgtcaaattaaggaaaggtttc 244  Q
    |||||||||||||||||||||||||||||||    
14812654 gttcttggatgtcaaattaaggaaaggtttc 14812624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 244
Target Start/End: Complemental strand, 15259847 - 15259619
Alignment:
14 aggtgaaaagtttgtaaaagatccaaaaaggttaaaggatcctatgatttttgttcaagaacttttggacatgaaagattagtatgatatagtatattaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||  |||||||||    
15259847 aggtgaaaagtttgtaaaagatccaaaaaggttaaaggatcctatgatttttgttcaagaacttttggacatgaaagataaatatgata--gtatattaa 15259750  T
114 acttggcatttaatcatgatgaagaattccatggagtgctggactcatcatttgagtacattattaacttgaatcacaatttgccagagtttctttcgtc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15259749 acttggcatttaatcatgatgaagaattccatggagtgctggactcatcatttgagtacattattaacttgaatcacaatttgccagagtttctttcgtc 15259650  T
214 gttcttggatgtcaaattaaggaaaggtttc 244  Q
    |||||||||||||||||||||||||||||||    
15259649 gttcttggatgtcaaattaaggaaaggtttc 15259619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 17521328 - 17521556
Alignment:
14 aggtgaaaagtttgtaaaagatccaaaaaggttaaaggatcctatgatttttgttcaagaacttttggacatgaaagattagtatgatatagtatattaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||  |||||||||    
17521328 aggtgaaaagtttgtaaaagatccaaaaaggttaaaggatcctatgatttttgttcaagaacttttggacatgaaagataaatatgata--gtatattaa 17521425  T
114 acttggcatttaatcatgatgaagaattccatggagtgctggactcatcatttgagtacattattaacttgaatcacaatttgccagagtttctttcgtc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17521426 acttggcatttaatcatgatgaagaattccatggagtgctggactcatcatttgagtacattattaacttgaatcacaatttgccagagtttctttcgtc 17521525  T
214 gttcttggatgtcaaattaaggaaaggtttc 244  Q
    |||||||||||||||||||||||||||||||    
17521526 gttcttggatgtcaaattaaggaaaggtttc 17521556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199019 times since January 2019
Visitors: 2774