View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_low_16 (Length: 382)

Name: NF0633_low_16
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0633_low_16
NF0633_low_16
[»] chr3 (3 HSPs)
chr3 (1-381)||(31063604-31063984)
chr3 (14-381)||(31074997-31075364)
chr3 (21-160)||(31057542-31057681)


Alignment Details
Target: chr3 (Bit Score: 369; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Original strand, 31063604 - 31063984
Alignment:
1 cctgatctgagaatttctcgctcatgcattctaagtctcttagcttctactaaggctgcaacaatcataaccatgactgaaaatgctaagccaatggcaa 100  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31063604 cctgatctgagaatttcttgctcatgcattctaagtctcttagcttctactaaggctgcaacaatcataaccatgactgaaaatgctaagccaatggcaa 31063703  T
101 ttcttctaaggatgctgatgcctctttcattaccagtgatttttctcataattggtacaagaactttgtcatataagggaacaaatatcaaggtgccaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31063704 ttcttctaaggatgctgatgcctctttcattaccagtgatttttctcataattggtacaagaactttgtcatataagggaacaaatatcaaggtgccaat 31063803  T
201 tgctgtaacagagacaacagaacctggtgggatagtgaaattgtcgcttagcttcaagttcatcgaagctgcttgttttacaaagagtgttgtagcttgt 300  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
31063804 tgctgtaacagagacaacagaacctggtgggattgtgaaattgtcgcttagcttcaagttcattgaagctgcttgttttacaaagagtgttgtagcttgt 31063903  T
301 gctaaagttattccagttgttaatgaagctagccatatggggattatgttaagaacaagctttgtttcttcaactcttgtc 381  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31063904 gctaaagttattccagttgttaatgaagctagccatatggggattatgttaagaacaagctttgtttcttcaactcttgtc 31063984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 14 - 381
Target Start/End: Original strand, 31074997 - 31075364
Alignment:
14 tttctcgctcatgcattctaagtctcttagcttctactaaggctgcaacaatcataaccatgactgaaaatgctaagccaatggcaattcttctaaggat 113  Q
    ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||  |||||||||| |||||||||||| ||    
31074997 tttcttgctcatgcattctaagtctcttagcttctactaatgctgcaacaatcataactatgactgaagatgtgaagccaatggaaattcttctaagtat 31075096  T
114 gctgatgcctctttcattaccagtgatttttctcataattggtacaagaactttgtcatataagggaacaaatatcaaggtgccaattgctgtaacagag 213  Q
    |||||| ||||||||||||||||||||||||||||  ||||| |||| ||  ||||||||||  |||||| |||| ||||||||||||||||   ||| |    
31075097 gctgattcctctttcattaccagtgatttttctcagcattggaacaataatcttgtcatatattggaacagatattaaggtgccaattgctgctgcagtg 31075196  T
214 acaacagaacctggtgggatagtgaaattgtcgcttagcttcaagttcatcgaagctgcttgttttacaaagagtgttgtagcttgtgctaaagttattc 313  Q
      ||||||| |||||||||| |||||| |||| |||| |||||||||||| ||||| |||||||||||||||||||| |   ||||||||| |  |||||    
31075197 gaaacagaagctggtgggattgtgaaactgtcacttatcttcaagttcattgaagcagcttgttttacaaagagtgtggagccttgtgctacacatattc 31075296  T
314 cagttgttaatgaagctagccatatggggattatgttaagaacaagctttgtttcttcaactcttgtc 381  Q
    | ||||||||||||| ||||||||| || ||||  || |||| ||||||||||||||| |||||||||    
31075297 ctgttgttaatgaagttagccatattggaattacattcagaataagctttgtttcttctactcttgtc 31075364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 21 - 160
Target Start/End: Original strand, 31057542 - 31057681
Alignment:
21 ctcatgcattctaagtctcttagcttctactaaggctgcaacaatcataaccatgactgaaaatgctaagccaatggcaattcttctaaggatgctgatg 120  Q
    |||| ||||||||||||||||| ||||||||||||||| || || |||||  ||| |||| | ||  ||||| |||   || || |||||||| ||||||    
31057542 ctcaagcattctaagtctcttaacttctactaaggctgaaagaaccataataatggctgagagtgtcaagccgatgtttatcctgctaaggatactgatg 31057641  T
121 cctctttcattaccagtgatttttctcataattggtacaa 160  Q
    ||||||||||| ||||||||||| ||||||||||| ||||    
31057642 cctctttcattgccagtgattttcctcataattggaacaa 31057681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 38134 times since January 2019
Visitors: 1598