View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_low_31 (Length: 251)

Name: NF0633_low_31
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0633_low_31
NF0633_low_31
[»] chr2 (2 HSPs)
chr2 (12-251)||(41028450-41028687)
chr2 (12-230)||(41035314-41035530)


Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 41028687 - 41028450
Alignment:
12 acagacgggtaaatcctaactataagcctcattgttcaacttacttttcaattgattatctaccagcagctgcatgatgtctttagagtccataatgaca 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||  |||||||||    
41028687 acagaagggtaaatcctaactataagcctcattgttcaacttacttttcaattgattatctaccagcagctgcatgatgtctttgaagt--ataatgaca 41028590  T
112 aggttaatggccgcaaaacacaggttttgaatcttttgattctgtgctatttgaagtcaccgcgacatggaaaaagcttcaaaaagaggaggatcagcac 211  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||    
41028589 aggttaatggccgcaaaacacaggttttgaatcttttgattccgtgctatttgaagtaaccgcgacatggcaaaagcttcaaaaagagtaggatcagcac 41028490  T
212 aaatttcctctgtttcacacgccaagagagccacactatt 251  Q
    ||||||||||||||||||| ||||||||||||||||||||    
41028489 aaatttcctctgtttcacaagccaagagagccacactatt 41028450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 230
Target Start/End: Complemental strand, 41035530 - 41035314
Alignment:
12 acagacgggtaaatcctaactataagcctcattgttcaacttacttttcaattgattatctaccagcagctgcatgatgtctttagagtccataatgaca 111  Q
    ||||| ||||| | ||||||||  |||| |||| |||||||||  | |||||||| ||||| ||||| ||||||||||||||||  |||||| ||| |||    
41035530 acagaagggtagaccctaactacgagccccattattcaacttatgtgtcaattgaatatctcccagctgctgcatgatgtctttgcagtccaaaataaca 41035431  T
112 aggttaatggccgcaaaacacaggttttgaatcttttgattctgtgctatttgaagtcaccgcgacatggaaaaagcttcaaaaagaggaggatcagcac 211  Q
    ||||||||||| |||||||||||||||||||||  |||||||  |||||||||||||||||||| ||||| |||||||||| |||||| ||||||| |||    
41035430 aggttaatggctgcaaaacacaggttttgaatc--ttgattccttgctatttgaagtcaccgcgccatggcaaaagcttcagaaagagtaggatcaacac 41035333  T
212 aaatttcctctgtttcaca 230  Q
    |||||||||||||||||||    
41035332 aaatttcctctgtttcaca 41035314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 125172 times since January 2019
Visitors: 1453