View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_low_31 (Length: 251)

Name: NF0633_low_31
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0633_low_31
[»] chr2 (2 HSPs)
chr2 (12-251)||(41028450-41028687)
chr2 (12-230)||(41035314-41035530)

Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 41028687 - 41028450
12 acagacgggtaaatcctaactataagcctcattgttcaacttacttttcaattgattatctaccagcagctgcatgatgtctttagagtccataatgaca 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||  |||||||||    
41028687 acagaagggtaaatcctaactataagcctcattgttcaacttacttttcaattgattatctaccagcagctgcatgatgtctttgaagt--ataatgaca 41028590  T
112 aggttaatggccgcaaaacacaggttttgaatcttttgattctgtgctatttgaagtcaccgcgacatggaaaaagcttcaaaaagaggaggatcagcac 211  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||    
41028589 aggttaatggccgcaaaacacaggttttgaatcttttgattccgtgctatttgaagtaaccgcgacatggcaaaagcttcaaaaagagtaggatcagcac 41028490  T
212 aaatttcctctgtttcacacgccaagagagccacactatt 251  Q
    ||||||||||||||||||| ||||||||||||||||||||    
41028489 aaatttcctctgtttcacaagccaagagagccacactatt 41028450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 230
Target Start/End: Complemental strand, 41035530 - 41035314
12 acagacgggtaaatcctaactataagcctcattgttcaacttacttttcaattgattatctaccagcagctgcatgatgtctttagagtccataatgaca 111  Q
    ||||| ||||| | ||||||||  |||| |||| |||||||||  | |||||||| ||||| ||||| ||||||||||||||||  |||||| ||| |||    
41035530 acagaagggtagaccctaactacgagccccattattcaacttatgtgtcaattgaatatctcccagctgctgcatgatgtctttgcagtccaaaataaca 41035431  T
112 aggttaatggccgcaaaacacaggttttgaatcttttgattctgtgctatttgaagtcaccgcgacatggaaaaagcttcaaaaagaggaggatcagcac 211  Q
    ||||||||||| |||||||||||||||||||||  |||||||  |||||||||||||||||||| ||||| |||||||||| |||||| ||||||| |||    
41035430 aggttaatggctgcaaaacacaggttttgaatc--ttgattccttgctatttgaagtcaccgcgccatggcaaaagcttcagaaagagtaggatcaacac 41035333  T
212 aaatttcctctgtttcaca 230  Q
41035332 aaatttcctctgtttcaca 41035314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 295607 times since January 2019
Visitors: 3016