View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_low_32 (Length: 245)

Name: NF0633_low_32
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0633_low_32
NF0633_low_32
[»] chr4 (1 HSPs)
chr4 (1-233)||(38027869-38028104)
[»] chr1 (1 HSPs)
chr1 (66-128)||(25790250-25790312)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 38028104 - 38027869
Alignment:
1 atgtactccatgaatattgtgcagtgataacaaaatcaacgcacatagcaaaataattttttggataaatagagacattgcacctttggttatt---ctt 97  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||    
38028104 atgtattccatgaatattgtgcagtgataacaaaatcaacgcacatagcaaaataattttttggataaatagagacattgcacctttggttattaatctt 38028005  T
98 ttctttggaagtgaataatattggatatatgtaggaagaaaaaacgtttgtatttatagaagattttgaggaaaaaatacatataacttcataaatgtaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
38028004 ttctttggaagtgaataatattggatatatgtaggaagaaaaaacatatgtatttatagaagattttgaggaaaaaatacataaaacttcataaatgtaa 38027905  T
198 taatattttaaatatttgggttgacctagtgatatt 233  Q
    ||||||||||||||||||||||||||||||||||||    
38027904 taatattttaaatatttgggttgacctagtgatatt 38027869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 128
Target Start/End: Complemental strand, 25790312 - 25790250
Alignment:
66 taaatagagacattgcacctttggttattcttttctttggaagtgaataatattggatatatg 128  Q
    |||| ||||||||| |||||||  ||| |||||||||||||| ||||||||||| | ||||||    
25790312 taaaaagagacatttcacctttaattaatcttttctttggaactgaataatatttgttatatg 25790250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 30632 times since January 2019
Visitors: 1588