View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_low_34 (Length: 237)

Name: NF0633_low_34
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0633_low_34
NF0633_low_34
[»] chr2 (5 HSPs)
chr2 (9-237)||(43777319-43777548)
chr2 (109-166)||(43780826-43780883)
chr2 (8-91)||(2995839-2995921)
chr2 (8-82)||(23914731-23914805)
chr2 (19-68)||(20625300-20625349)
[»] chr1 (4 HSPs)
chr1 (8-85)||(42561685-42561762)
chr1 (8-84)||(42560995-42561071)
chr1 (22-68)||(34969385-34969431)
chr1 (8-68)||(40368038-40368098)
[»] chr5 (3 HSPs)
chr5 (8-82)||(27175125-27175199)
chr5 (9-85)||(3955885-3955961)
chr5 (22-68)||(42027689-42027735)
[»] chr4 (4 HSPs)
chr4 (22-68)||(32547389-32547435)
chr4 (8-91)||(17982095-17982177)
chr4 (22-68)||(2133521-2133567)
chr4 (22-68)||(18419292-18419338)
[»] chr8 (3 HSPs)
chr8 (21-86)||(7718313-7718378)
chr8 (18-83)||(13765852-13765917)
chr8 (49-89)||(14537999-14538039)
[»] chr3 (2 HSPs)
chr3 (11-80)||(49758125-49758194)
chr3 (8-84)||(37681301-37681377)
[»] scaffold0009 (1 HSPs)
scaffold0009 (9-68)||(53670-53729)
[»] chr7 (1 HSPs)
chr7 (9-81)||(24650234-24650306)
[»] chr6 (1 HSPs)
chr6 (8-84)||(16260397-16260473)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 237
Target Start/End: Original strand, 43777319 - 43777548
Alignment:
9 caacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctctcattcctcatgtatattgttttg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43777319 caacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctctcattcctcatgtatattgttttg 43777418  T
109 ttaaagactcttatatattgttatagataatatggttcttatcatcagctagttgaacggtttctttctctttaatcccatcagcttttttctctttccg 208  Q
    ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
43777419 ttaaagactcttatatattgttatagataatattgttcttattatcagctagttgaacggtttctttctctttaatcccatcagcttctttctctttccg 43777518  T
209 atgatatgaaatcggatc-aatattacgaa 237  Q
    |||||||||||||||||| |||||||||||    
43777519 atgatatgaaatcggatcaaatattacgaa 43777548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 43780826 - 43780883
Alignment:
109 ttaaagactcttatatattgttatagataatatggttcttatcatcagctagttgaac 166  Q
    ||||||| | ||||||||||||||||||||||| |||||||| ||||| |||||||||    
43780826 ttaaagatttttatatattgttatagataatattgttcttattatcagttagttgaac 43780883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 2995921 - 2995839
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctctcattcc 91  Q
    ||||||||||||||||| |||||||||  ||||| ||| |  |||||| ||||||||||||| |||  |||||| |||||||||    
2995921 ccaacaatatatcattactatagaaaattttgtttaag-gtgtaattggaataatgaaaaatgtaggtcaaaatatctcattcc 2995839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 23914805 - 23914731
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatc 82  Q
    ||||||||||| |||| ||||||  ||  ||||| ||||| ||||||| |||||||||||||| || ||||||||    
23914805 ccaacaatataacattcttataggcaaatttgtttaagagtataattggaataatgaaaaatccagtccaaaatc 23914731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 20625349 - 20625300
Alignment:
19 tcattattatagaaaagattgttaaagagaataattgaaataatgaaaaa 68  Q
    |||||||||||||||| ||||||  |||| |||||||| |||||||||||    
20625349 tcattattatagaaaaaattgttttagagtataattgagataatgaaaaa 20625300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 85
Target Start/End: Original strand, 42561685 - 42561762
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctct 85  Q
    ||||||||||| |||| ||||||||||  ||||| ||| ||||||||| ||||||||||||   ||||||||||||||    
42561685 ccaacaatataacattgttatagaaaaatttgttgaagggaataattggaataatgaaaaagtcagcccaaaatctct 42561762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 42560995 - 42561071
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctc 84  Q
    ||||||||||| |||||||||||||||  ||||| ||| | ||||||| |||||||||||||| |  ||||||||||    
42560995 ccaacaatataacattattatagaaaaatttgtttaagggtataattggaataatgaaaaatccaatccaaaatctc 42561071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 34969385 - 34969431
Alignment:
22 ttattatagaaaagattgttaaagagaataattgaaataatgaaaaa 68  Q
    ||||||||||||| |||||| ||||| ||||||| ||||||||||||    
34969385 ttattatagaaaaaattgtttaagagtataattggaataatgaaaaa 34969431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 40368098 - 40368038
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaa 68  Q
    ||||||||||| ||||| |||||||||  ||||| ||| | ||||||| ||||||||||||    
40368098 ccaacaatataacattaatatagaaaaatttgtttaagggtataattggaataatgaaaaa 40368038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 27175199 - 27175125
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatc 82  Q
    ||||||||||| ||||||||||||||| |||||| ||  | ||||||| |||||  ||||||| |||||||||||    
27175199 ccaacaatataacattattatagaaaacattgtttaatggtataattggaataacaaaaaatccagcccaaaatc 27175125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 3955885 - 3955961
Alignment:
9 caacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctct 85  Q
    ||||||||||||||||||| ||||||  ||||| ||  | | ||||| |||||||||||||| | ||||||||||||    
3955885 caacaatatatcattattaaagaaaaatttgtttaaaggtacaattggaataatgaaaaatccaacccaaaatctct 3955961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 42027689 - 42027735
Alignment:
22 ttattatagaaaagattgttaaagagaataattgaaataatgaaaaa 68  Q
    ||||||||||||| |||||| ||||| |||||||| |||||||||||    
42027689 ttattatagaaaaaattgtttaagagtataattgagataatgaaaaa 42027735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 32547389 - 32547435
Alignment:
22 ttattatagaaaagattgttaaagagaataattgaaataatgaaaaa 68  Q
    ||||||||||||| |||||| ||||| ||||||||||||||||||||    
32547389 ttattatagaaaaaattgtttaagagtataattgaaataatgaaaaa 32547435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 17982177 - 17982095
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctctcattcc 91  Q
    ||||||||||||||||| |||||||||  ||||| ||| |  |||||| ||||||||||||| |||  |||||| |||||||||    
17982177 ccaacaatatatcattactatagaaaattttgtttaag-gtgtaattggaataatgaaaaatgtaggtcaaaatatctcattcc 17982095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 2133567 - 2133521
Alignment:
22 ttattatagaaaagattgttaaagagaataattgaaataatgaaaaa 68  Q
    ||||||||||||| |||||| ||||| |||||||| |||||||||||    
2133567 ttattatagaaaaaattgtttaagagtataattgagataatgaaaaa 2133521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 18419338 - 18419292
Alignment:
22 ttattatagaaaagattgttaaagagaataattgaaataatgaaaaa 68  Q
    ||||||||||||| |||||| ||| | ||||||||||||||||||||    
18419338 ttattatagaaaaaattgttcaagggtataattgaaataatgaaaaa 18419292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 86
Target Start/End: Original strand, 7718313 - 7718378
Alignment:
21 attattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctctc 86  Q
    ||||||||||||||| ||||| |||   ||||||  ||||||||||||||||| ||||||||||||    
7718313 attattatagaaaagtttgttcaaggatataattagaataatgaaaaatctagtccaaaatctctc 7718378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 13765917 - 13765852
Alignment:
18 atcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatct 83  Q
    ||||||||||||||||| ||||||  |||| |||||| | ||||||||||||  ||||||||||||    
13765917 atcattattatagaaaaaattgttttagagtataatttagataatgaaaaattcagcccaaaatct 13765852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 89
Target Start/End: Complemental strand, 14538039 - 14537999
Alignment:
49 ataattgaaataatgaaaaatctagcccaaaatctctcatt 89  Q
    |||||||||||||| |||||| |||||||||||||||||||    
14538039 ataattgaaataataaaaaatatagcccaaaatctctcatt 14537999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 80
Target Start/End: Original strand, 49758125 - 49758194
Alignment:
11 acaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaa 80  Q
    ||||||||  |||||||||||||| |||||| ||| | |||||||||||||| ||||||| | |||||||    
49758125 acaatataatattattatagaaaaaattgtttaagggtataattgaaataataaaaaatccaacccaaaa 49758194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 37681377 - 37681301
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctc 84  Q
    ||||||||||| ||||| ||||| |||  ||||| ||| | ||||||||||| || ||||||  |||||||||||||    
37681377 ccaacaatataacattaatataggaaaatttgtttaagggtataattgaaattataaaaaattcagcccaaaatctc 37681301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 53729 - 53670
Alignment:
9 caacaatatatcattattatagaaaagattg-ttaaagagaataattgaaataatgaaaaa 68  Q
    |||||||||| |||||||||||||||  ||| |||||||  ||||||||||||||||||||    
53729 caacaatataacattattatagaaaaatttgtttaaaga-tataattgaaataatgaaaaa 53670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 24650306 - 24650234
Alignment:
9 caacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaat 81  Q
    |||||||||  |||||||| || |||| ||||| ||| |  |||||||||||||||||||| ||||| |||||    
24650306 caacaatattgcattattacaggaaagtttgtttaagggtttaattgaaataatgaaaaatgtagcctaaaat 24650234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 16260397 - 16260473
Alignment:
8 ccaacaatatatcattattatagaaaagattgttaaagagaataattgaaataatgaaaaatctagcccaaaatctc 84  Q
    |||||||||||  |||||||||| |||  ||||| |||  |||| |||||||||||||||||  | |||||||||||    
16260397 ccaacaatataatattattataggaaaatttgtttaaggtaatagttgaaataatgaaaaattaaacccaaaatctc 16260473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175793 times since January 2019
Visitors: 2679