View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0633_low_35 (Length: 228)

Name: NF0633_low_35
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0633_low_35
[»] chr3 (1 HSPs)
chr3 (1-228)||(24830766-24830986)

Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 24830766 - 24830986
1 tcatcatgaaaaacaattaaccctcttaaaaaccttaatcaccttacacagatgcttacaacataaaattaaccagaagcctcaaaatcgcggtgcaatc 100  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||       |||||||||||| |||||||||||||||||||||||||||||||    
24830766 tcatcatgaaaaacaaataaccctcttaaaaaccttaatcaccttacac-------tacaacataaaactaaccagaagcctcaaaatcgcggtgcaatc 24830858  T
101 ggaaaccttaattaaacatttttgtctttccaatcaaccatcatcaacattcttgacactatttactgcataatatttgcttctaccctcagaaataaca 200  Q
    || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
24830859 gggaaccttaattaaacatttttgtctttccaatcaaccattatcaacattcttgacactatttactgcataatatttgcttctgccctcagaaataaca 24830958  T
201 aggactaagtcgtcacacaaatgaatca 228  Q
24830959 aggactaagtcgtcacacaaatgaatca 24830986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 18001 times since January 2019
Visitors: 1567