View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0806_high_3 (Length: 459)

Name: NF0806_high_3
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0806_high_3
NF0806_high_3
[»] chr8 (1 HSPs)
chr8 (13-452)||(43455754-43456193)


Alignment Details
Target: chr8 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 13 - 452
Target Start/End: Complemental strand, 43456193 - 43455754
Alignment:
13 actatggtacgaacatccagaaagttaatatcaaagaagctcaaataatttctatgatttagaattcaatatatcatgaaacctgatgtttctagcaaga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43456193 actatggtacgaacatccagaaagttaatatcaaagaagctcaaataatttctatgatttagaattcaatatatcatgaaacctgatgtttctagcaaga 43456094  T
113 attaagtatttatatatacacacaaaccatatatgtgtgagatacctttatagcagttccatccaaggaagagccagctgcatatataagttcaccatga 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43456093 attaagtatttatatatacacacaaaccatatatgtgtgagatacctttatagcagttccatccaaggaagagccagctgcatatataagttcaccatga 43455994  T
213 acttgcagtgcatgaataggatatgctttcccaagtaatcttttagaaccactttgaatattactgatagttccagtggccaaatgtatctcctgaaata 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43455993 acttgcagtgcatgaataggatatgctttcccaagtaatcttttagaaccactttgaatattactgatagttccagtggccaaatgtatctcctgaaata 43455894  T
313 tgacaatattattatcacaaatatgtcgagataacatcacatactcaagttgagatagcatcacattggatttaggctatgtcgtacttcttaaaacttg 412  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43455893 tgacaataatattatcacaaatatgtcgagataacatcacatactcaagttgagatagcatcacattggatttaggctatgtcgtacttcttaaaacttg 43455794  T
413 atacctgaacactactgtcgtggcatccacagtataatct 452  Q
    ||||||||||||||||||||||||||||||||||||||||    
43455793 atacctgaacactactgtcgtggcatccacagtataatct 43455754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 191999 times since January 2019
Visitors: 2831