View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0806_high_5 (Length: 354)

Name: NF0806_high_5
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0806_high_5
[»] chr8 (1 HSPs)
chr8 (1-354)||(43456184-43456537)

Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 43456537 - 43456184
1 gctacatcaaggcgtgaaatgagaatataatataaccatttgaaattaaaacttcaagcaaaatttttgtcacctgaatttgtccatctgaagttccaat 100  Q
43456537 gctacatcaaggcgtgaaatgagaatataatataaccatttgaaattaaaacttcaagcaaaatttttgtcacctgaatttgtccatctgaagttccaat 43456438  T
101 caccaaaatttgttcattgctgtctagagccatgcaattaaccttacaatttgtacccaactgtaacgtgccaactttaatgtgtttcttatcccaaatt 200  Q
43456437 caccaaaatttgttcattgctgtctagagccatgcaattaaccttacaatttgtacccaactgtaacgtgccaactttaatgtgtttcttatcccaaatt 43456338  T
201 tctacaacacctcccttgcaccccaaataaattaattctgaactcactgccatagcccgcacttctgatccagtttgcagtgatccaaccatgctgtaat 300  Q
43456337 tctacaacacctcccttgcaccccaaataaattaattctgaactcactgccatagcccgcacttctgatccagtttgcagtgatccaaccatgctgtaat 43456238  T
301 tggaattgttccatatcttgacgtatatgtaaaacagtcagttaactatggtac 354  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
43456237 tggaattattccatatcttgacgtatatgtaaaacagtcagttaactatggtac 43456184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 198997 times since January 2019
Visitors: 2774