View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0806_high_5 (Length: 354)

Name: NF0806_high_5
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0806_high_5
NF0806_high_5
[»] chr8 (1 HSPs)
chr8 (1-354)||(43456184-43456537)


Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 43456537 - 43456184
Alignment:
1 gctacatcaaggcgtgaaatgagaatataatataaccatttgaaattaaaacttcaagcaaaatttttgtcacctgaatttgtccatctgaagttccaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43456537 gctacatcaaggcgtgaaatgagaatataatataaccatttgaaattaaaacttcaagcaaaatttttgtcacctgaatttgtccatctgaagttccaat 43456438  T
101 caccaaaatttgttcattgctgtctagagccatgcaattaaccttacaatttgtacccaactgtaacgtgccaactttaatgtgtttcttatcccaaatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43456437 caccaaaatttgttcattgctgtctagagccatgcaattaaccttacaatttgtacccaactgtaacgtgccaactttaatgtgtttcttatcccaaatt 43456338  T
201 tctacaacacctcccttgcaccccaaataaattaattctgaactcactgccatagcccgcacttctgatccagtttgcagtgatccaaccatgctgtaat 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43456337 tctacaacacctcccttgcaccccaaataaattaattctgaactcactgccatagcccgcacttctgatccagtttgcagtgatccaaccatgctgtaat 43456238  T
301 tggaattgttccatatcttgacgtatatgtaaaacagtcagttaactatggtac 354  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
43456237 tggaattattccatatcttgacgtatatgtaaaacagtcagttaactatggtac 43456184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18158 times since January 2019
Visitors: 1568