View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0806_low_19 (Length: 250)

Name: NF0806_low_19
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0806_low_19
[»] chr7 (1 HSPs)
chr7 (8-250)||(7163655-7163897)

Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 7163897 - 7163655
8 ccaataatattaagcctatgtatagcatcaataacaagcaatgaaaacaactcgcttcgcaatatgtcatatccacttcctataatatcatatttaatca 107  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||    
7163897 ccaataatattcagcctatgtatagcatcaataacaatcaatgaaaacaactcgcttcgcaatatgtcatatcctcttcatataatatcatatttaatca 7163798  T
108 tattaggatcttagatttgattatcaatatcctcgtcaataaaattaaggagtaaatttgagttacactcgttaaatacctcttagaagattttatatgt 207  Q
7163797 tattaggatcttagatttgattatcaatatcctcgtcaataaaattaaggagtaaatttgagttacactcgttaaatacctcttagaagattttatatgt 7163698  T
208 cttcaactgtgatgcaattattgtgtgtaagaggtggatgcca 250  Q
7163697 cttcaactgtgatgcaattattgtgtgtaagaggtggatgcca 7163655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 199127 times since January 2019
Visitors: 2774