View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0806_low_19 (Length: 250)

Name: NF0806_low_19
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0806_low_19
NF0806_low_19
[»] chr7 (1 HSPs)
chr7 (8-250)||(7163655-7163897)


Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 7163897 - 7163655
Alignment:
8 ccaataatattaagcctatgtatagcatcaataacaagcaatgaaaacaactcgcttcgcaatatgtcatatccacttcctataatatcatatttaatca 107  Q
    ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||    
7163897 ccaataatattcagcctatgtatagcatcaataacaatcaatgaaaacaactcgcttcgcaatatgtcatatcctcttcatataatatcatatttaatca 7163798  T
108 tattaggatcttagatttgattatcaatatcctcgtcaataaaattaaggagtaaatttgagttacactcgttaaatacctcttagaagattttatatgt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7163797 tattaggatcttagatttgattatcaatatcctcgtcaataaaattaaggagtaaatttgagttacactcgttaaatacctcttagaagattttatatgt 7163698  T
208 cttcaactgtgatgcaattattgtgtgtaagaggtggatgcca 250  Q
    |||||||||||||||||||||||||||||||||||||||||||    
7163697 cttcaactgtgatgcaattattgtgtgtaagaggtggatgcca 7163655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18541 times since January 2019
Visitors: 1569