View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0806_low_20 (Length: 235)

Name: NF0806_low_20
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0806_low_20
NF0806_low_20
[»] chr7 (1 HSPs)
chr7 (13-235)||(7162951-7163173)
[»] chr4 (1 HSPs)
chr4 (198-235)||(12703800-12703837)


Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 7162951 - 7163173
Alignment:
13 attaatttgcttaacatatgaaaaatgttttgatcaagtaacaaacatttttagtaccgattcatattttggctataaaactatgatatactttgacacc 112  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||    
7162951 attaatttgcttaatgtatgaaaaatgttttgatcaagtaacaaacggttttagtaccgattcatattttggctataaaactatgatatactttgacacc 7163050  T
113 aatggagatcagaataaaatataagatgtttatggttgctttaaaaatattgtagcgagtgataaagaaaagaataccgagcagggtgttggttttgtga 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7163051 aatggagatcagaataaaatataagatgtttatggttgctttaaaaatattgtagcgagtgataaagaaaagaataccgagcagggtgttggttttgtga 7163150  T
213 attctctttgtgtagagagtatt 235  Q
    |||||||||||||||||||||||    
7163151 attctctttgtgtagagagtatt 7163173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 235
Target Start/End: Original strand, 12703800 - 12703837
Alignment:
198 gtgttggttttgtgaattctctttgtgtagagagtatt 235  Q
    |||||||||| |||||||||||||||| ||||||||||    
12703800 gtgttggtttggtgaattctctttgtgcagagagtatt 12703837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 37762 times since January 2019
Visitors: 1597