View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0806_low_4 (Length: 459)

Name: NF0806_low_4
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0806_low_4
[»] chr8 (1 HSPs)
chr8 (13-452)||(43455754-43456193)

Alignment Details
Target: chr8 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 13 - 452
Target Start/End: Complemental strand, 43456193 - 43455754
13 actatggtacgaacatccagaaagttaatatcaaagaagctcaaataatttctatgatttagaattcaatatatcatgaaacctgatgtttctagcaaga 112  Q
43456193 actatggtacgaacatccagaaagttaatatcaaagaagctcaaataatttctatgatttagaattcaatatatcatgaaacctgatgtttctagcaaga 43456094  T
113 attaagtatttatatatacacacaaaccatatatgtgtgagatacctttatagcagttccatccaaggaagagccagctgcatatataagttcaccatga 212  Q
43456093 attaagtatttatatatacacacaaaccatatatgtgtgagatacctttatagcagttccatccaaggaagagccagctgcatatataagttcaccatga 43455994  T
213 acttgcagtgcatgaataggatatgctttcccaagtaatcttttagaaccactttgaatattactgatagttccagtggccaaatgtatctcctgaaata 312  Q
43455993 acttgcagtgcatgaataggatatgctttcccaagtaatcttttagaaccactttgaatattactgatagttccagtggccaaatgtatctcctgaaata 43455894  T
313 tgacaatattattatcacaaatatgtcgagataacatcacatactcaagttgagatagcatcacattggatttaggctatgtcgtacttcttaaaacttg 412  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43455893 tgacaataatattatcacaaatatgtcgagataacatcacatactcaagttgagatagcatcacattggatttaggctatgtcgtacttcttaaaacttg 43455794  T
413 atacctgaacactactgtcgtggcatccacagtataatct 452  Q
43455793 atacctgaacactactgtcgtggcatccacagtataatct 43455754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 109659 times since January 2019
Visitors: 1349