View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION10 (Length: 670)

Name: NF0920-INSERTION10
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION10
NF0920-INSERTION10
[»] chr7 (3 HSPs)
chr7 (1-670)||(6550964-6551638)
chr7 (26-308)||(49061300-49061582)
chr7 (372-448)||(49061675-49061751)


Alignment Details
Target: chr7 (Bit Score: 613; Significance: 0; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 613; E-Value: 0
Query Start/End: Original strand, 1 - 670
Target Start/End: Complemental strand, 6551638 - 6550964
Alignment:
1 cccatcggtcactccagaaagtaaatcatcctcgtccgggagtagatttccaataatttgagcctcgagttcttcaagagagtcagaaagcttctcttcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6551638 cccatcggtcactccagaaagtaaatcatcctcgtccgggagtagatttccaataatttgagcctcgagttcttcaagagagtcagaaagcttctcttcc 6551539  T
101 tcataatttgatgcaattgtatccactgaatgtccatataaagcattattcgcagataatcgcactacaccgacagaaaaatacaaagacatagcagatt 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||    
6551538 tcataatttgatgcaattgtatccactgaatgtccatagaaagcattattcgcagataatcgcactacaccaacagaaacatacaaagacatagtagatt 6551439  T
201 agccaacaattttcacagtaaactttagcatacaattttgcaaagaaaactcacatttcttgctgaacaaatctgacagagaacttgagaaaaggctgct 300  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6551438 agccaacaattttcacagtaaactttagcataaaattttgcaaagaaaactcacatttcttgctgaacaaatctgacagagaacttgagaaaaggctgct 6551339  T
301 ttcgtgccgagaggcaactatatcatcttctttactatcttcaaagggttttattccttgatcagaatctacatgacataacaaagtcaaagaataattg 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6551338 ttcgtgccgagaggcaactatatcatcttctttactatcttcaaagggttttattccttgatcagaatctacatgacataacaaagtcaaagaataattg 6551239  T
401 gatgtgtcattttcatcaacaaagtaaggcatcaatgcatgtctat------gactttatttctgcacaattataacaagaatcttggtcgaacgttttt 494  Q
    ||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||| ||||||||||||||||||||||||||||    
6551238 gatgtgtcattttcatcaacaaagtaaggcatcaatgcatgtctatgactatgactttatttctgcacaatcataacaagaatcttggtcgaacgttttt 6551139  T
495 ctgtacaaatattccttacaatacggcccttttccaaatttaagtttaaatttataaaacatggatattgaaattgagatttagatatgttcaaaataac 594  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6551138 ctgtacaaatattccttacaatacggcccttttccaaatttaagtttaaatttataaaacatggatattgaaattgagatttagatatgttcaaaataac 6551039  T
595 ataaatattatgaaaccagaaacaagcgaattaaaacaaacgtgcattatgctaaaaatatatatataacgaaatg 670  Q
    ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
6551038 atatatattatgaaa-cagaaacaagcgaattaaaacaaacgtgcattatgctaaaaatatatatacaacgaaatg 6550964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 26 - 308
Target Start/End: Original strand, 49061300 - 49061582
Alignment:
26 tcatcctcgtccgggagtagatttccaataatttgagcctcgagttcttcaagagagtcagaaagcttctcttcctcataatttgatgcaattgtatcca 125  Q
    |||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||| |||||    
49061300 tcatcctcatcctggagtagatttccaatagtttgagcctcgagttcttcaagagagacacaaagcttctcttcctcataatgtgatgcaattgcatcca 49061399  T
126 ctgaatgtccatataaagcattattcgcagataatcgcactacaccgacagaaaaatacaaagacatagcagattagccaacaattttcacagtaaactt 225  Q
    |||||||||||| ||||||||||||| ||||||||||||||  ||  || |||  |||||||||||||||| ||||| ||| | |||| |||  ||||||    
49061400 ctgaatgtccatgtaaagcattattcacagataatcgcactgtacgaactgaagcatacaaagacatagcatattagtcaatagttttgacaagaaactt 49061499  T
226 tagcatacaattttgcaaagaaaactcacatttcttgctgaacaaatctgacagagaacttgagaaaaggctgctttcgtgcc 308  Q
    ||||||||||||||| |||||||||| || |||| |||| |||||||||||  ||||||||||||| || || ||||||||||    
49061500 tagcatacaattttgaaaagaaaacttacgtttcctgctaaacaaatctgatggagaacttgagaagagactactttcgtgcc 49061582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 372 - 448
Target Start/End: Original strand, 49061675 - 49061751
Alignment:
372 catgacataacaaagtcaaagaataattggatgtgtcattttcatcaacaaagtaaggcatcaatgcatgtctatga 448  Q
    |||| |||||||||||||||||||||||||||||  | |||| | ||||||| ||  |||||||||||||| |||||    
49061675 catggcataacaaagtcaaagaataattggatgtaccgtttttaccaacaaactagagcatcaatgcatgtatatga 49061751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141999 times since January 2019
Visitors: 1479