View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION12 (Length: 669)

Name: NF0920-INSERTION12
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION12
NF0920-INSERTION12
[»] chr6 (4 HSPs)
chr6 (183-559)||(3345404-3345782)
chr6 (7-103)||(3345781-3345877)
chr6 (550-625)||(3344923-3344998)
chr6 (618-669)||(3344851-3344902)
[»] chr2 (4 HSPs)
chr2 (130-247)||(13019110-13019228)
chr2 (130-244)||(9252229-9252344)
chr2 (130-246)||(37490684-37490801)
chr2 (139-199)||(37262703-37262763)
[»] chr7 (1 HSPs)
chr7 (128-198)||(28283769-28283839)


Alignment Details
Target: chr6 (Bit Score: 324; Significance: 0; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 183 - 559
Target Start/End: Complemental strand, 3345782 - 3345404
Alignment:
183 ttctgtctcgttggattgtagaggcctatataccaagttgtttttgccccaatgaactcccctcattctccttttaaacacatcgacccaacaaaattct 282  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||    
3345782 ttctgtctcgttggattgtagaggtctatataccaagttgtttttgccccaacgaactcccctcattctccttttaaacacatcgacccaacaaaatcct 3345683  T
283 tgctccttaaaaattacaaatatttaattatgttagatgatttagatttaaaagtactgttaattatccttctaagtaagttctattaattaattaactt 382  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||    
3345682 tgctacttaaaaattacaaatatttaattatgttagatgatttagatttaaaagtactattaattacccttctaagtaagttctattaattaattaactt 3345583  T
383 gatg--tacacacacaagatatgtggggtttgtctaatattggaaggaggtcatcaaaaagctttttagtgtgtttggcaagttctaatcagtggtgtga 480  Q
    ||||  ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3345582 gatgtatacacacacaaaatatgtggggtttgtctaatattggaaggaggtcatcaaaaagctttttagtgtgtttggcaagttctaatcagtggtgtga 3345483  T
481 atgagttagtggaagaattcaacatgaattattgcacaaattggtttaacataaaatttaggtattcatattttattag 559  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||| ||||    
3345482 atgagttagtggaagaattcaacatgaattatggcacaaattggttcaacataaaatgtaggtattcatatttttttag 3345404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 3345877 - 3345781
Alignment:
7 aagttttaaatgaggctttgcaaccattcataatagcgtcaaaaatggaactgatgctaagattgttagagatttcgtcaaccatttgcttacaatt 103  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||    
3345877 aagttttagatgaggttttgcaaccattcataatagcgtcaaaaatggaattgatgttaagattgttagagatttcgtcaaccatttacttacaatt 3345781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 550 - 625
Target Start/End: Complemental strand, 3344998 - 3344923
Alignment:
550 attttattagaagaaagtgagaaatgtacaaatagtacttaacctattcatgtggctatcaaaaagagttccaact 625  Q
    |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||    
3344998 attttattagaagaaagtgagaaattgacaaatagtacttaacctattcatgtggctatcaaaaagagttccaact 3344923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 618 - 669
Target Start/End: Complemental strand, 3344902 - 3344851
Alignment:
618 ttccaactaaccataacttagttaggagttgaatcatggaaaaggatgctaa 669  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3344902 ttccaactaaccataacttagttaggagttgaatcatggaaaaggatgctaa 3344851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 1e-24; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 130 - 247
Target Start/End: Original strand, 13019110 - 13019228
Alignment:
130 gaagaaaatctcaaattatcaaaccaatttattgcttcttttaaacctcttgcttctgtctcgttggattgt-agaggcctatataccaagttgtttttg 228  Q
    |||||||||||| ||||  ||||| ||||||| |||||||||||||| |||||||||| |||||||||||||  ||||||| || |||||||||| || |    
13019110 gaagaaaatctcgaattgccaaacgaatttatcgcttcttttaaaccacttgcttctgcctcgttggattgtgggaggcctttaaaccaagttgtcttcg 13019209  T
229 ccccaatgaactcccctca 247  Q
    ||| |||||||||||||||    
13019210 ccctaatgaactcccctca 13019228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 130 - 244
Target Start/End: Complemental strand, 9252344 - 9252229
Alignment:
130 gaagaaaatctcaaattatcaaaccaatttattgcttcttttaaacctcttgcttctgtctcgttggattgt-agaggcctatataccaagttgtttttg 228  Q
    |||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||   |||||||||||||  ||  ||| || |||||||||| || |    
9252344 gaagaaaacctcaaattatcaaaccaatttatcgcttcttttaaatctcttgcttccacctcgttggattgtgggatacctttaaaccaagttgtattcg 9252245  T
229 ccccaatgaactcccc 244  Q
    ||||||||||||||||    
9252244 ccccaatgaactcccc 9252229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 246
Target Start/End: Complemental strand, 37490801 - 37490684
Alignment:
130 gaagaaaatctcaaattatcaaaccaatttattgcttcttttaaacctcttgcttctgtctcgttggattgtag-aggcctatataccaagttgtttttg 228  Q
    |||| ||| ||||||||| |||  |||||||| ||||||||||||||| |||||||   | ||||||||||| | |||||| || || ||||||| || |    
37490801 gaaggaaacctcaaattaccaagacaatttatcgcttcttttaaaccttttgcttcctccacgttggattgtggaaggcctttaaacgaagttgtcttcg 37490702  T
229 ccccaatgaactcccctc 246  Q
    | |||||| |||||||||    
37490701 ctccaatgtactcccctc 37490684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 139 - 199
Target Start/End: Complemental strand, 37262763 - 37262703
Alignment:
139 ctcaaattatcaaaccaatttattgcttcttttaaacctcttgcttctgtctcgttggatt 199  Q
    ||||||||| ||| |||||||||| | ||||||| |||| |||||||  ||||||||||||    
37262763 ctcaaattaccaagccaatttattccatcttttacacctattgcttccatctcgttggatt 37262703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 128 - 198
Target Start/End: Complemental strand, 28283839 - 28283769
Alignment:
128 cagaagaaaatctcaaattatcaaaccaatttattgcttcttttaaacctcttgcttctgtctcgttggat 198  Q
    |||||| ||| |||||||||  || |||||||||||||||||||||| | |||||||| | | ||||||||    
28283839 cagaaggaaacctcaaattactaagccaatttattgcttcttttaaaacccttgcttccgccgcgttggat 28283769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142475 times since January 2019
Visitors: 1480