View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION3 (Length: 731)

Name: NF0920-INSERTION3
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION3
NF0920-INSERTION3
[»] chr2 (3 HSPs)
chr2 (8-731)||(15886085-15886826)
chr2 (257-330)||(19935604-19935677)
chr2 (260-330)||(26368802-26368872)
[»] chr4 (4 HSPs)
chr4 (260-330)||(17779544-17779614)
chr4 (507-560)||(46389319-46389372)
chr4 (381-474)||(48211958-48212051)
chr4 (507-560)||(48212084-48212137)
[»] scaffold0068 (1 HSPs)
scaffold0068 (507-560)||(6787-6840)
[»] chr5 (4 HSPs)
chr5 (507-560)||(21707070-21707123)
chr5 (239-330)||(5580231-5580322)
chr5 (257-327)||(16983862-16983932)
chr5 (253-294)||(34671961-34672002)
[»] scaffold0015 (1 HSPs)
scaffold0015 (229-327)||(80235-80333)
[»] chr1 (1 HSPs)
chr1 (296-330)||(39219517-39219551)


Alignment Details
Target: chr2 (Bit Score: 559; Significance: 0; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 559; E-Value: 0
Query Start/End: Original strand, 8 - 731
Target Start/End: Original strand, 15886085 - 15886826
Alignment:
8 aatgcatcaatcatatcgcacctcctctttgtggatgattgttttttattgtgtagagctaatgctaatgaagccatcaaaatgaagaatattttgtcca 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
15886085 aatgcatcaatcatatcgcacctcctctttgtggatgattgttttttattgtctagagctaatgctaatgaagccatcaaaatgaagaatattttgtcca 15886184  T
108 ttta----cataaaagtcttaagtcc------gaatcttnnnnnnnnnnnnttgagatttttagtaccagaaatgaatcacaacatcgcataaaaacata 197  Q
    ||||    |||||||||||||||||       |||||||            ||||||||||| |||||||||||| ||||||||||||||||||||||||    
15886185 tttaattacataaaagtcttaagtcaagctatgaatcttaaaaaaaaaa--ttgagattttttgtaccagaaatgtatcacaacatcgcataaaaacata 15886282  T
198 gcaaacaagcttgggt-----ttgttcttggtac-ggtaaatatctaggctgaccttcttcgatcggaagaagtaagaaagcaactttcagttttatcaa 291  Q
    ||||||||||||||||     ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15886283 gcaaacaagcttgggtccaggttgttcttggtaccggtaaatatctaggctgaccttcttcgatcggaagaagtaagaaagcaactttcagttttatcaa 15886382  T
292 agataagatttggaagaaaattaattcatggagtagtaa----cttttcaagggaatgatataaaggttcttattaaattggtgctccactctattccaa 387  Q
    |||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
15886383 agataagatttggaagaaaattaattcatggagtagtaagagacttttcaagggaatgatataaaggttcttattaaattggtgctccactctatttcaa 15886482  T
388 cctatcttatgagcttgttcactctgcatgtatcgttttgtgatgaaatagaaaagataatgaacacgttttggtggggtcattcagaagctcaaaacaa 487  Q
    ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||    
15886483 cctatcttatgagcttgttcactcttcatgtatcgttgtgtgatgaaatagaaaagatgataaacacgttttggtggggtcattcagaagctcaaaacaa 15886582  T
488 cggtatttgtgggctctaatgggacaaattatccatgcacaaaaagaatggaggtatgagctttaaaaatctttctttagtatagctatgcttgggaaat 587  Q
     |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
15886583 tggtatttgtgggctctaatgggacaaattatccatgcacataaagaatggaggtatgagctttaaaaatctttctttagtatagttatgcttgggaaat 15886682  T
588 aggagtggagacgtatgataaatcccgactctcattgctagactatataanggaagatattatttcccgttgcaaattttcttttaatctaaattggggc 687  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
15886683 aggagtggagaggtatgataaatcccgactctcattgctagactatataaaggaagatattatttcccgttgcaaattttcttttaatctaaattggggc 15886782  T
688 ataagcccagctttgtgtagaaaagtatatgtaagaataacacg 731  Q
    |||||||||||||||||||||||||||||||||||| |||||||    
15886783 ataagcccagctttgtgtagaaaagtatatgtaagattaacacg 15886826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 257 - 330
Target Start/End: Complemental strand, 19935677 - 19935604
Alignment:
257 ggaagaagtaagaaagcaactttcagttttatcaaagataagatttggaagaaaattaattcatggagtagtaa 330  Q
    ||||||||||| ||||| || |||| ||| |||||||||   ||||||||||||||||| |||||||| |||||    
19935677 ggaagaagtaaaaaagcgacgttcaatttcatcaaagatcgcatttggaagaaaattaactcatggagcagtaa 19935604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 260 - 330
Target Start/End: Original strand, 26368802 - 26368872
Alignment:
260 agaagtaagaaagcaactttcagttttatcaaagataagatttggaagaaaattaattcatggagtagtaa 330  Q
    |||||||||||||||||||||   ||||| ||||| |  |||||||| || |||||||| |||||||||||    
26368802 agaagtaagaaagcaactttcgagtttattaaagacagaatttggaaaaagattaattcctggagtagtaa 26368872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.000000000001; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 260 - 330
Target Start/End: Complemental strand, 17779614 - 17779544
Alignment:
260 agaagtaagaaagcaactttcagttttatcaaagataagatttggaagaaaattaattcatggagtagtaa 330  Q
    ||||||||||||||||||||| | ||||| |||||||  |||||||| || |||||||| |||||||||||    
17779614 agaagtaagaaagcaactttcgggtttattaaagatagaatttggaaaaagattaattcctggagtagtaa 17779544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 507 - 560
Target Start/End: Complemental strand, 46389372 - 46389319
Alignment:
507 tgggacaaattatccatgcacaaaaagaatggaggtatgagctttaaaaatctt 560  Q
    |||||||||||||| || |  |||||  ||||||||||||||||||||||||||    
46389372 tgggacaaattatctattcttaaaaaagatggaggtatgagctttaaaaatctt 46389319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 381 - 474
Target Start/End: Original strand, 48211958 - 48212051
Alignment:
381 attccaacctatcttatgagcttgttcactctgcatgtatcgttttgtgatgaaatagaaaagataatgaacacgttttggtggggtcattcag 474  Q
    |||||||| ||| |||||||||| || ||||| | | | ||||| |||||||| || || ||||| |||||| | |||||||||||||| ||||    
48211958 attccaacgtattttatgagcttatttactctacctttgtcgttgtgtgatgagattgagaagatgatgaactctttttggtggggtcactcag 48212051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 507 - 560
Target Start/End: Original strand, 48212084 - 48212137
Alignment:
507 tgggacaaattatccatgcacaaaaagaatggaggtatgagctttaaaaatctt 560  Q
    |||||||||||||| ||||| |||||  |||||||||||  |||||||||||||    
48212084 tgggacaaattatctatgcataaaaaagatggaggtatgtcctttaaaaatctt 48212137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 507 - 560
Target Start/End: Complemental strand, 6840 - 6787
Alignment:
507 tgggacaaattatccatgcacaaaaagaatggaggtatgagctttaaaaatctt 560  Q
    |||||||||||||| ||||| |||||  ||||||||||||||||||||||||||    
6840 tgggacaaattatctatgcataaaaaagatggaggtatgagctttaaaaatctt 6787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000004; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 507 - 560
Target Start/End: Original strand, 21707070 - 21707123
Alignment:
507 tgggacaaattatccatgcacaaaaagaatggaggtatgagctttaaaaatctt 560  Q
    |||||||||||||| ||||| |||||  ||||||||||||||||||||||||||    
21707070 tgggacaaattatctatgcataaaaaagatggaggtatgagctttaaaaatctt 21707123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 239 - 330
Target Start/End: Original strand, 5580231 - 5580322
Alignment:
239 ggctgaccttcttcgatcggaagaagtaagaaagcaactttcagttttatcaaagataagatttggaagaaaattaattcatggagtagtaa 330  Q
    |||| |||||||  ||| ||||||||||| ||||| || |||| ||| |||||||||   ||||||||||||||||| |||||||| |||||    
5580231 ggcttaccttctatgattggaagaagtaaaaaagcgacgttcaatttcatcaaagatcgcatttggaagaaaattaactcatggagcagtaa 5580322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 257 - 327
Target Start/End: Original strand, 16983862 - 16983932
Alignment:
257 ggaagaagtaagaaagcaactttcagttttatcaaagataagatttggaagaaaattaattcatggagtag 327  Q
    |||||||||||||||| |||||| | ||| || || |||| ||||||||| ||||||||||| ||||||||    
16983862 ggaagaagtaagaaagaaacttttaatttcattaaggataggatttggaacaaaattaattcgtggagtag 16983932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 34671961 - 34672002
Alignment:
253 gatcggaagaagtaagaaagcaactttcagttttatcaaaga 294  Q
    ||||||||||||||||||| ||||||||| ||||||||||||    
34671961 gatcggaagaagtaagaaatcaactttcaattttatcaaaga 34672002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 229 - 327
Target Start/End: Original strand, 80235 - 80333
Alignment:
229 taaatatctaggctgaccttcttcgatcggaagaagtaagaaagcaactttcagttttatcaaagataagatttggaagaaaattaattcatggagtag 327  Q
    |||||||||||||| ||| | |  |||  |||||||||| || || || |||| ||||||||||||| | ||||||||||| || ||||| ||||||||    
80235 taaatatctaggcttaccgtatatgattagaagaagtaaaaaggcgacgttcaattttatcaaagatcatatttggaagaagataaattcttggagtag 80333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 296 - 330
Target Start/End: Original strand, 39219517 - 39219551
Alignment:
296 aagatttggaagaaaattaattcatggagtagtaa 330  Q
    ||||| |||||||||||||||||||||||||||||    
39219517 aagatatggaagaaaattaattcatggagtagtaa 39219551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142253 times since January 2019
Visitors: 1479