View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION4 (Length: 710)

Name: NF0920-INSERTION4
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION4
NF0920-INSERTION4
[»] chr1 (2 HSPs)
chr1 (198-710)||(42236141-42236653)
chr1 (11-104)||(42235954-42236047)


Alignment Details
Target: chr1 (Bit Score: 501; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 501; E-Value: 0
Query Start/End: Original strand, 198 - 710
Target Start/End: Original strand, 42236141 - 42236653
Alignment:
198 agagaataccgtaaaggtaattggacaatccaagaaacacttattctcatcacagccaagaaactagacgatgaacgtagactaagaaacacttcaacat 297  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42236141 agagaataccgtaaaggtaattggacaatccaagaaacacttattctcatcacagccaagaaactagacgatgaacgtagactaagaaacacttcaacat 42236240  T
298 caacctcaactccatcatcctcatcacaagacccaaataggacaccaaacactacacatgtcacctccattgcaagccctagcaccagtaccagcaagag 397  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
42236241 caacctcaactccatcatcatcatcacaagacccaaataggacaccaaacactacacatgtcacctccattgcaagccctagcaccagtaccagcaggag 42236340  T
398 cagtggtgaactgagatggaaatgggtggaaaactattgttggagccatggttgtttgagaagccagaatcaatgtaatgataaatgggataacttactt 497  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42236341 cagtggtgaactgagatggaaatgggtggaaaactattgttggagccatggttgtttgagaagccagaatcaatgtaatgataaatgggataacttactt 42236440  T
498 cgtgattacaaaaaagttcgtgattatgaatccaaatcagaatcatcaccacccaacaacaatagcaacaaagatcattttccttcttattggattctca 597  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42236441 cgtgattacaaaaaagttcgtgattatgaatccaaatcagaatcatcaccacccaacaacaatagcaacaaagatcattttccttcttattggattctca 42236540  T
598 acaaacaacaacgtaaagaacaaaatcttccttctaatatggtttttgaagtttatcaagctataagtgaagttcttcaaagaaaacaatcacaaagaaa 697  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
42236541 acaaacaacaacgtaaagaacaaaatcttccttctaatatggtttttgaagtttatcaagctataagtgaagttcttcaaaggaaacaatcacaaagaaa 42236640  T
698 caaccccactcca 710  Q
    |||||||||||||    
42236641 caaccccactcca 42236653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 90; E-Value: 4e-43
Query Start/End: Original strand, 11 - 104
Target Start/End: Original strand, 42235954 - 42236047
Alignment:
11 aattcattaattcactcaccaaatctcatgccaaatctaaacaatgtctgatccttcgacttccaccaccccattaccacatccatcaatccta 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
42235954 aattcattaattcactcaccaaatctcatgccaaatctaaacaatgtctgatccttccacttccaccaccccattaccacatccatcaatccta 42236047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136975 times since January 2019
Visitors: 1443