View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION5 (Length: 358)

Name: NF0920-INSERTION5
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION5
NF0920-INSERTION5
[»] chr4 (1 HSPs)
chr4 (8-358)||(4074937-4075288)
[»] chr7 (1 HSPs)
chr7 (31-60)||(25824895-25824924)


Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 8 - 358
Target Start/End: Complemental strand, 4075288 - 4074937
Alignment:
8 gtctccctggtgtgcctgatacttggaatgagcttctttatgcctatattttccatagatgacaaacatttgatattgaaaactttaagtacaatacgtt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||    
4075288 gtctccctggtgtgcctgatacttggaatgagcttctttatgcctatattttccatagatgacaaacatttgatattgaaaacttgaagtaaaatatgtt 4075189  T
108 acatttatgtttggtttggtttgttatcttgttttctcttgatgttgactgaggtgagggaagttgaagtgtaaagaatattgttatccctaatccttaa 207  Q
    |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4075188 acatttatctttggtttgttttgttatcttgttttctcttgatgttgactgaggtgagggaagttgaagtgtaaagaatattgttatccctaatccttaa 4075089  T
208 aaaacatgcatatgctagtg-nnnnnnnnnaatgtcatgtatctttttcatcacaatgatacttgtttaccttattaaacaaaaaattagacctagtttc 306  Q
    ||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4075088 aaaacatgcatatgctagtgttttttttttaatgtcatgtatctttttcatcacaatgatacttgtttaccttattaaacaaaaaattagacctagtttc 4074989  T
307 aagctgaatgacataaaagtaatggcgacagtagttagatccaaaatattct 358  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||    
4074988 aagctgaatgacataaaagtaatggcgacagtagttggatccaaaatattct 4074937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 60
Target Start/End: Original strand, 25824895 - 25824924
Alignment:
31 tggaatgagcttctttatgcctatattttc 60  Q
    ||||||||||||||||||||||||||||||    
25824895 tggaatgagcttctttatgcctatattttc 25824924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137500 times since January 2019
Visitors: 1448