View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION6 (Length: 466)

Name: NF0920-INSERTION6
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION6
NF0920-INSERTION6
[»] chr3 (1 HSPs)
chr3 (12-466)||(6026235-6026688)


Alignment Details
Target: chr3 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 12 - 466
Target Start/End: Complemental strand, 6026688 - 6026235
Alignment:
12 tgaagatggtaatggaattgttgatatggaggaagggcctggattgacccttcctagggcacatccgttggtatgtatacctacggctaagctccatctt 111  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
6026688 tgaagatggtaatggaattgttgaaatggaggaagggcctggattgacccttcctagggcacatccgttggtatgtatacctacggctaggctccatctt 6026589  T
112 ttttagccactttgattaatgtcagacatattctctccaacggtccaccacatccaataaaatatcgacggttgaatcatgattgtatctcgatttaatc 211  Q
    ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |    
6026588 ttttagcaactttgattaatgtcagacatattctctgcaacggtccaccacatccaataaaatttcgaaggttgaatcatgattgtatctcgatttaacc 6026489  T
212 gttgagatacgatggattaaccctagtacgtataggatgtgagtttgatttatgtttggtttgtgcattcagttcatttagtcgctttacttatttaatg 311  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||    
6026488 gttgagatacgatggattaaccctagtacgtataggatgtgagtttgatttatgtttgttttgtgcattcagttcatttagtccctttacttatttaatg 6026389  T
312 aatgtaaaaagataaattnnnnnnncatctctactctcttgtgtggaaaattagcatgagatgtttttgtgaggaagttcatgtttgtatagtttttatt 411  Q
    || | |||||||||||||       |||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||| |||||||    
6026388 aacgcaaaaagataaattagaaaaacatctctactctcttgtgtgtaaaattagcatgagatgtttttgtgcggaagtttatgtttgtatag-ttttatt 6026290  T
412 gccaaacaaaaattgtgttgtttttcttttctaaaacaaaatgtgttgtttatat 466  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6026289 gccaaacaaaaattgtgttgtttttcttttctaaaacaaaatgtgttgtttatat 6026235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142359 times since January 2019
Visitors: 1480