View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0920-INSERTION6 (Length: 466)
Name: NF0920-INSERTION6
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0920-INSERTION6 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 12 - 466
Target Start/End: Complemental strand, 6026688 - 6026235
Alignment:
Q |
12 |
tgaagatggtaatggaattgttgatatggaggaagggcctggattgacccttcctagggcacatccgttggtatgtatacctacggctaagctccatctt |
111 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
6026688 |
tgaagatggtaatggaattgttgaaatggaggaagggcctggattgacccttcctagggcacatccgttggtatgtatacctacggctaggctccatctt |
6026589 |
T |
 |
Q |
112 |
ttttagccactttgattaatgtcagacatattctctccaacggtccaccacatccaataaaatatcgacggttgaatcatgattgtatctcgatttaatc |
211 |
Q |
|
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | |
|
|
T |
6026588 |
ttttagcaactttgattaatgtcagacatattctctgcaacggtccaccacatccaataaaatttcgaaggttgaatcatgattgtatctcgatttaacc |
6026489 |
T |
 |
Q |
212 |
gttgagatacgatggattaaccctagtacgtataggatgtgagtttgatttatgtttggtttgtgcattcagttcatttagtcgctttacttatttaatg |
311 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
6026488 |
gttgagatacgatggattaaccctagtacgtataggatgtgagtttgatttatgtttgttttgtgcattcagttcatttagtccctttacttatttaatg |
6026389 |
T |
 |
Q |
312 |
aatgtaaaaagataaattnnnnnnncatctctactctcttgtgtggaaaattagcatgagatgtttttgtgaggaagttcatgtttgtatagtttttatt |
411 |
Q |
|
|
|| | ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||| ||||||| |
|
|
T |
6026388 |
aacgcaaaaagataaattagaaaaacatctctactctcttgtgtgtaaaattagcatgagatgtttttgtgcggaagtttatgtttgtatag-ttttatt |
6026290 |
T |
 |
Q |
412 |
gccaaacaaaaattgtgttgtttttcttttctaaaacaaaatgtgttgtttatat |
466 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6026289 |
gccaaacaaaaattgtgttgtttttcttttctaaaacaaaatgtgttgtttatat |
6026235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 142359 times since January 2019
Visitors: 1480