View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION7 (Length: 795)

Name: NF0920-INSERTION7
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION7
NF0920-INSERTION7
[»] chr2 (4 HSPs)
chr2 (337-743)||(31595475-31595882)
chr2 (7-144)||(31594995-31595132)
chr2 (151-272)||(31595291-31595412)
chr2 (16-124)||(36572193-36572303)
[»] chr6 (2 HSPs)
chr6 (34-143)||(1673670-1673779)
chr6 (26-79)||(31989431-31989484)
[»] chr4 (1 HSPs)
chr4 (375-498)||(23066756-23066883)
[»] scaffold0060 (1 HSPs)
scaffold0060 (28-100)||(54013-54085)
[»] chr1 (1 HSPs)
chr1 (537-567)||(36194825-36194855)


Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-169; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-169
Query Start/End: Original strand, 337 - 743
Target Start/End: Original strand, 31595475 - 31595882
Alignment:
337 ttgagtttgattgattgtatgtcctatcaaattgtataaaatgaatatttataggcaaaactattattactggccacgacatgacctacaatgtttagtc 436  Q
    |||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |    
31595475 ttgagtttgattgattgtatgtcctatcaaattgta-aagatgagtatttataggcaaaattattattactgaccacgacatgacctacaatgtttagcc 31595573  T
437 ttacccaactatttgtgcgggtagtgcgtaagttttctctcattgaaggggtatgtggcacccacgttcggctagtag--gtccaattcacaacaagata 534  Q
    |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||  ||||| ||||||||| ||||    
31595574 ttacccaactatttgtgcaggtagtgcgtaagctttctctcattgaaggggtatgtggcacccacgttcggctagtagctgtccatttcacaacatgata 31595673  T
535 tgttgacaaagttcaatgtgtgcaacctcccttagaatgtgtatttgtgtccatcactccttttgtttagtgtcactttaaataaagagcacgcgttagt 634  Q
    |||||||||||||||||||| |||| |||||||| ||||||| ||||||||||||| |||||||||||||||||||| |||||| |||||| ||||||||    
31595674 tgttgacaaagttcaatgtgcgcaaactcccttaaaatgtgtctttgtgtccatcattccttttgtttagtgtcactataaatacagagcatgcgttagt 31595773  T
635 tgcctcactatccaatttcacttattgttgactaagtctgatgttctaaagatccatgtattatttggtagactcgtcaaagaaataactgactcttatt 734  Q
    ||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||    
31595774 tgcctcaatgtccaatttcacttagtgttgactaagtctgatgttctaaagatccatgtattactcggtagactcgtcaaagaaataactgactcttatt 31595873  T
735 ccactgtag 743  Q
    |||||||||    
31595874 ccactgtag 31595882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 7 - 144
Target Start/End: Original strand, 31594995 - 31595132
Alignment:
7 aaaactaattattaagatcttaagtatgagaagaaaaagagataaaagagctttatagctcaaatgcaagtaaagttcattggaaattatattgatttaa 106  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||    
31594995 aaaactacttattaagatcttaagtatgagaagaaaaagagataaaagagctttatagctaaaatgcaagtaaagttcatcggaaattatattgatttaa 31595094  T
107 atatagtcatttttgtacgcaatagttctatttataga 144  Q
    ||||||||||||||||||| |||| |||| ||||||||    
31595095 atatagtcatttttgtacgtaatacttctgtttataga 31595132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 151 - 272
Target Start/End: Original strand, 31595291 - 31595412
Alignment:
151 tctcaactttgatttccttatatcaaacgattagactgaagaaagaattctctctcaaatttatggattcattaataacttcagtagagcgttaaataca 250  Q
    |||||||||||||||||||||||||||||||||||  | ||||| |||| | |||||||||||||||||||||||||| |||||||||||||||||||||    
31595291 tctcaactttgatttccttatatcaaacgattagatcggagaaaaaattttgtctcaaatttatggattcattaataatttcagtagagcgttaaataca 31595390  T
251 atgtttttgaagtttttaacga 272  Q
    ||||||||||||||||||||||    
31595391 atgtttttgaagtttttaacga 31595412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 16 - 124
Target Start/End: Original strand, 36572193 - 36572303
Alignment:
16 tattaagatcttaagtatgagaagaaaaaga--gataaaagagctttatagctcaaatgcaagtaaagttcattggaaattatattgatttaaatatagt 113  Q
    ||||||||| || ||||| |||||||||| |  |||||||||| |||||| ||||| || ||||||| || |||| |||||||||||||  ||| |||||    
36572193 tattaagattttgagtataagaagaaaaaaaacgataaaagagttttataactcaagtgaaagtaaaatttattgaaaattatattgatcaaaagatagt 36572292  T
114 catttttgtac 124  Q
     |||| |||||    
36572293 gatttgtgtac 36572303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 54; Significance: 1e-21; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 34 - 143
Target Start/End: Complemental strand, 1673779 - 1673670
Alignment:
34 gagaagaaaaagagataaaagagctttatagctcaaatgcaagtaaagttcattggaaattatattgatttaaatatagtcatttttgtacgcaatagtt 133  Q
    ||||| |||||||||||||||| |||||||||||||||| ||||||| || ||||||||||||||||||  ||| || || |||| |||||  |||| ||    
1673779 gagaaaaaaaagagataaaagaactttatagctcaaatgaaagtaaaatttattggaaattatattgatgaaaagatggtgatttgtgtacataatactt 1673680  T
134 ctatttatag 143  Q
    ||||||||||    
1673679 ctatttatag 1673670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 26 - 79
Target Start/End: Complemental strand, 31989484 - 31989431
Alignment:
26 ttaagtatgagaagaaaaagagataaaagagctttatagctcaaatgcaagtaa 79  Q
    |||||||| || |||||||||||||||||||||| |||||||||||| ||||||    
31989484 ttaagtattaggagaaaaagagataaaagagcttaatagctcaaatgaaagtaa 31989431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 375 - 498
Target Start/End: Original strand, 23066756 - 23066883
Alignment:
375 aaatgaatatttataggcaaaactattattactggcca--cgacatgacctacaatgtttagtcttacccaactatttgtgcgggtagtgcg--taagtt 470  Q
    |||||| |||||||| |||||||| || ||| | ||||  ||||| ||||||||||||||| ||| || ||||||||||||  |||||||||  | ||||    
23066756 aaatgagtatttatatgcaaaactcttcttattagccaaacgacaagacctacaatgtttattctgactcaactatttgtgaaggtagtgcgctttagtt 23066855  T
471 ttctctcattgaaggggtatgtggcacc 498  Q
    ||| |||| ||| |||||||||||||||    
23066856 ttccctcactgagggggtatgtggcacc 23066883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 100
Target Start/End: Original strand, 54013 - 54085
Alignment:
28 aagtatgagaagaaaaagagataaaagagctttatagctcaaatgcaagtaaagttcattggaaattatattg 100  Q
    |||||| || ||||||||||||||||||| || |||||||||||| ||||||  || || | |||||||||||    
54013 aagtattaggagaaaaagagataaaagagtttaatagctcaaatgaaagtaatatttatagaaaattatattg 54085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 537 - 567
Target Start/End: Complemental strand, 36194855 - 36194825
Alignment:
537 ttgacaaagttcaatgtgtgcaacctccctt 567  Q
    |||||||||||||||||||||||||||||||    
36194855 ttgacaaagttcaatgtgtgcaacctccctt 36194825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137114 times since January 2019
Visitors: 1444