View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION8 (Length: 525)

Name: NF0920-INSERTION8
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION8
NF0920-INSERTION8
[»] chr4 (57 HSPs)
chr4 (9-262)||(30864868-30865121)
chr4 (364-487)||(47867872-47867995)
chr4 (364-486)||(20281585-20281707)
chr4 (364-486)||(4058709-4058831)
chr4 (364-486)||(26916319-26916441)
chr4 (364-487)||(2229240-2229363)
chr4 (364-486)||(14332754-14332876)
chr4 (383-486)||(29203500-29203603)
chr4 (372-486)||(20716174-20716288)
chr4 (364-486)||(56318106-56318228)
chr4 (375-486)||(10069691-10069802)
chr4 (364-486)||(5483314-5483436)
chr4 (364-486)||(39078151-39078272)
chr4 (364-486)||(41414647-41414768)
chr4 (365-486)||(55580663-55580785)
chr4 (366-486)||(17794579-17794699)
chr4 (364-462)||(7654635-7654733)
chr4 (364-462)||(16604882-16604980)
chr4 (364-486)||(28669037-28669158)
chr4 (371-480)||(24940365-24940474)
chr4 (397-486)||(52535654-52535743)
chr4 (364-486)||(1585383-1585505)
chr4 (392-486)||(35310806-35310900)
chr4 (392-486)||(35529666-35529760)
chr4 (364-486)||(42915523-42915646)
chr4 (364-486)||(48793664-48793784)
chr4 (364-475)||(5815474-5815585)
chr4 (373-476)||(5841824-5841927)
chr4 (364-486)||(8683342-8683462)
chr4 (383-442)||(17186850-17186909)
chr4 (371-476)||(46070565-46070668)
chr4 (371-476)||(8178282-8178387)
chr4 (392-486)||(25297286-25297380)
chr4 (371-485)||(50145731-50145845)
chr4 (364-475)||(19351851-19351964)
chr4 (371-452)||(47516234-47516315)
chr4 (405-486)||(50080528-50080609)
chr4 (382-476)||(23978169-23978263)
chr4 (364-486)||(32323298-32323419)
chr4 (371-476)||(5064698-5064803)
chr4 (365-422)||(21722719-21722776)
chr4 (371-415)||(32410393-32410437)
chr4 (371-486)||(14583723-14583837)
chr4 (381-471)||(17799187-17799277)
chr4 (371-474)||(32203226-32203322)
chr4 (371-416)||(49080321-49080366)
chr4 (380-475)||(40553774-40553869)
chr4 (364-400)||(16473828-16473864)
chr4 (371-415)||(29511490-29511534)
chr4 (395-486)||(31280193-31280280)
chr4 (373-476)||(8013134-8013237)
chr4 (373-436)||(25268523-25268586)
chr4 (371-458)||(28142665-28142752)
chr4 (445-486)||(32280104-32280145)
chr4 (371-476)||(37911888-37911993)
chr4 (392-440)||(8018420-8018468)
chr4 (384-416)||(28318473-28318505)
[»] chr8 (51 HSPs)
chr8 (364-487)||(7022447-7022570)
chr8 (364-486)||(34890218-34890340)
chr8 (364-486)||(36190766-36190888)
chr8 (364-487)||(26483525-26483648)
chr8 (364-486)||(31734109-31734231)
chr8 (372-486)||(8711870-8711985)
chr8 (372-486)||(7858522-7858636)
chr8 (364-486)||(43216391-43216513)
chr8 (364-486)||(15957955-15958079)
chr8 (371-486)||(28348605-28348719)
chr8 (364-486)||(13143758-13143880)
chr8 (364-486)||(41086430-41086552)
chr8 (376-486)||(34158347-34158457)
chr8 (371-486)||(8107669-8107783)
chr8 (364-486)||(24892832-24892957)
chr8 (377-486)||(35456081-35456190)
chr8 (391-486)||(7499720-7499816)
chr8 (364-462)||(35525605-35525703)
chr8 (389-481)||(3642039-3642130)
chr8 (395-486)||(4046969-4047060)
chr8 (364-472)||(30575878-30575987)
chr8 (376-486)||(2052830-2052938)
chr8 (373-476)||(17713227-17713330)
chr8 (371-486)||(29920319-29920434)
chr8 (380-457)||(2628224-2628301)
chr8 (371-476)||(26954443-26954548)
chr8 (364-486)||(8709830-8709950)
chr8 (367-486)||(41755920-41756038)
chr8 (364-486)||(16879436-16879558)
chr8 (364-448)||(13143989-13144073)
chr8 (372-476)||(8673385-8673489)
chr8 (412-486)||(15824723-15824797)
chr8 (377-449)||(16358168-16358240)
chr8 (373-476)||(8745587-8745690)
chr8 (383-476)||(25195109-25195202)
chr8 (371-476)||(41362358-41362463)
chr8 (381-476)||(14576213-14576301)
chr8 (371-476)||(17336746-17336851)
chr8 (372-476)||(4038933-4039037)
chr8 (364-440)||(44663833-44663909)
chr8 (373-475)||(5217397-5217499)
chr8 (444-486)||(13144085-13144127)
chr8 (373-435)||(28497191-28497253)
chr8 (380-477)||(39187237-39187334)
chr8 (407-471)||(7670749-7670813)
chr8 (380-476)||(27819663-27819759)
chr8 (380-486)||(33563571-33563681)
chr8 (371-414)||(4480841-4480884)
chr8 (371-458)||(38072185-38072272)
chr8 (392-477)||(31133101-31133186)
chr8 (371-415)||(14693434-14693478)
[»] chr7 (45 HSPs)
chr7 (364-487)||(45485950-45486073)
chr7 (364-487)||(25737669-25737792)
chr7 (364-487)||(46760299-46760422)
chr7 (364-487)||(35923247-35923370)
chr7 (377-487)||(14805865-14805975)
chr7 (377-487)||(15252859-15252969)
chr7 (364-486)||(18102526-18102648)
chr7 (364-486)||(25944572-25944694)
chr7 (364-487)||(19912811-19912934)
chr7 (364-486)||(4910675-4910797)
chr7 (371-486)||(20123729-20123844)
chr7 (364-486)||(6191041-6191163)
chr7 (364-486)||(22632085-22632207)
chr7 (384-486)||(47557663-47557765)
chr7 (380-486)||(47779600-47779706)
chr7 (376-486)||(9158086-9158195)
chr7 (364-486)||(11780014-11780135)
chr7 (380-486)||(14574560-14574666)
chr7 (365-448)||(12632387-12632470)
chr7 (392-486)||(15995715-15995809)
chr7 (384-486)||(2610630-2610732)
chr7 (391-486)||(44682874-44682968)
chr7 (364-427)||(35068891-35068954)
chr7 (373-476)||(38260322-38260425)
chr7 (376-442)||(4069043-4069109)
chr7 (391-487)||(4237784-4237880)
chr7 (380-475)||(24151640-24151734)
chr7 (373-476)||(39170540-39170643)
chr7 (391-485)||(27810804-27810898)
chr7 (383-461)||(31549964-31550042)
chr7 (380-480)||(48413723-48413820)
chr7 (371-486)||(16917468-16917582)
chr7 (381-458)||(8015732-8015807)
chr7 (445-486)||(12633110-12633151)
chr7 (371-476)||(31769011-31769116)
chr7 (392-477)||(21654150-21654235)
chr7 (371-476)||(35888018-35888123)
chr7 (380-477)||(48879388-48879485)
chr7 (395-475)||(22369233-22369313)
chr7 (389-476)||(3777984-3778071)
chr7 (373-416)||(10248594-10248637)
chr7 (373-416)||(40560443-40560486)
chr7 (448-486)||(35068961-35068999)
chr7 (438-485)||(4068972-4069020)
chr7 (373-477)||(35084111-35084215)
[»] chr3 (72 HSPs)
chr3 (364-487)||(23311595-23311718)
chr3 (364-487)||(37042419-37042542)
chr3 (364-482)||(579140-579258)
chr3 (364-487)||(30189569-30189693)
chr3 (364-486)||(6438083-6438205)
chr3 (364-486)||(14752210-14752332)
chr3 (364-486)||(28875406-28875528)
chr3 (364-486)||(50651039-50651161)
chr3 (371-486)||(47864191-47864306)
chr3 (371-486)||(7866492-7866607)
chr3 (375-487)||(11054325-11054433)
chr3 (364-486)||(6075081-6075203)
chr3 (364-486)||(46711660-46711781)
chr3 (364-486)||(53270233-53270357)
chr3 (371-486)||(36546542-36546657)
chr3 (371-486)||(36561658-36561773)
chr3 (364-486)||(37074958-37075082)
chr3 (385-486)||(54464918-54465019)
chr3 (372-486)||(35963152-35963266)
chr3 (371-486)||(2927289-2927404)
chr3 (364-486)||(32619832-32619954)
chr3 (380-481)||(34722623-34722724)
chr3 (364-486)||(19464075-19464197)
chr3 (364-486)||(41476338-41476453)
chr3 (398-486)||(46557237-46557325)
chr3 (373-476)||(8097029-8097132)
chr3 (371-486)||(50730109-50730223)
chr3 (371-486)||(50782631-50782745)
chr3 (384-486)||(8703109-8703209)
chr3 (384-486)||(9054996-9055096)
chr3 (364-485)||(20847270-20847391)
chr3 (364-433)||(23910515-23910584)
chr3 (380-486)||(3972275-3972381)
chr3 (380-486)||(3997497-3997603)
chr3 (377-486)||(29235193-29235296)
chr3 (374-476)||(34194892-34194994)
chr3 (392-486)||(6752670-6752764)
chr3 (392-486)||(26208014-26208108)
chr3 (373-458)||(16032998-16033083)
chr3 (417-486)||(33974614-33974683)
chr3 (390-486)||(47866941-47867036)
chr3 (373-476)||(30454736-30454838)
chr3 (364-486)||(26724993-26725115)
chr3 (371-476)||(38401384-38401489)
chr3 (373-476)||(7886628-7886731)
chr3 (364-427)||(9264610-9264673)
chr3 (371-476)||(10114915-10115020)
chr3 (371-476)||(10252015-10252120)
chr3 (371-476)||(22479063-22479168)
chr3 (397-486)||(38674870-38674959)
chr3 (380-476)||(46918231-46918327)
chr3 (430-486)||(48802548-48802604)
chr3 (371-476)||(10014273-10014378)
chr3 (371-476)||(22456017-22456122)
chr3 (371-476)||(48291826-48291931)
chr3 (372-476)||(21214245-21214349)
chr3 (371-439)||(31836966-31837034)
chr3 (383-486)||(47115849-47115952)
chr3 (392-477)||(51426621-51426706)
chr3 (373-477)||(31126214-31126318)
chr3 (423-486)||(9264008-9264071)
chr3 (373-475)||(23209291-23209393)
chr3 (364-422)||(33973569-33973627)
chr3 (380-422)||(54725628-54725670)
chr3 (381-438)||(3084199-3084256)
chr3 (383-414)||(6784390-6784421)
chr3 (447-486)||(23910580-23910619)
chr3 (446-481)||(34722564-34722599)
chr3 (380-458)||(36150946-36151025)
chr3 (392-477)||(1335112-1335197)
chr3 (371-476)||(47443983-47444087)
chr3 (419-486)||(41936248-41936313)
[»] chr5 (48 HSPs)
chr5 (364-486)||(11261927-11262049)
chr5 (375-487)||(6686379-6686491)
chr5 (364-487)||(43590005-43590128)
chr5 (364-486)||(20644010-20644132)
chr5 (364-486)||(38130159-38130281)
chr5 (364-486)||(32110998-32111120)
chr5 (372-486)||(37562813-37562927)
chr5 (371-486)||(38280843-38280958)
chr5 (372-485)||(37522640-37522754)
chr5 (364-486)||(42273645-42273765)
chr5 (364-486)||(34425327-34425448)
chr5 (364-484)||(20039100-20039220)
chr5 (364-485)||(19413138-19413259)
chr5 (371-486)||(8225459-8225573)
chr5 (377-486)||(32017700-32017808)
chr5 (372-485)||(104265-104386)
chr5 (364-486)||(4463356-4463478)
chr5 (364-486)||(25840860-25840982)
chr5 (390-486)||(9957488-9957581)
chr5 (364-486)||(39505276-39505397)
chr5 (371-476)||(12912344-12912449)
chr5 (380-486)||(17351384-17351490)
chr5 (364-486)||(41625554-41625675)
chr5 (380-482)||(43454382-43454484)
chr5 (378-486)||(7071234-7071342)
chr5 (380-476)||(10153987-10154083)
chr5 (371-481)||(42104298-42104408)
chr5 (364-486)||(5984151-5984280)
chr5 (380-476)||(5369090-5369186)
chr5 (371-476)||(3463865-3463970)
chr5 (383-448)||(12792839-12792903)
chr5 (373-476)||(8506443-8506540)
chr5 (444-486)||(12730103-12730145)
chr5 (383-448)||(12729937-12730001)
chr5 (371-416)||(29307237-29307282)
chr5 (371-415)||(8959707-8959751)
chr5 (364-448)||(23233445-23233529)
chr5 (381-477)||(31690680-31690776)
chr5 (449-486)||(12792929-12792966)
chr5 (392-477)||(24439575-24439660)
chr5 (371-442)||(6391909-6391980)
chr5 (371-442)||(30703641-30703712)
chr5 (383-477)||(12638892-12638986)
chr5 (373-415)||(32432319-32432361)
chr5 (371-476)||(5736290-5736395)
chr5 (371-416)||(16153396-16153440)
chr5 (385-476)||(5659584-5659676)
chr5 (373-477)||(8146065-8146169)
[»] chr2 (43 HSPs)
chr2 (364-486)||(28599190-28599312)
chr2 (364-487)||(35517118-35517241)
chr2 (364-486)||(3201322-3201444)
chr2 (364-486)||(28858305-28858427)
chr2 (383-486)||(41528252-41528355)
chr2 (371-486)||(45085253-45085368)
chr2 (364-486)||(45660361-45660483)
chr2 (364-486)||(19264095-19264218)
chr2 (364-486)||(6110241-6110365)
chr2 (364-486)||(14873958-14874081)
chr2 (364-486)||(33198673-33198795)
chr2 (371-486)||(11617020-11617135)
chr2 (364-486)||(29524083-29524205)
chr2 (380-486)||(40584456-40584562)
chr2 (365-483)||(8701601-8701719)
chr2 (364-486)||(25572042-25572163)
chr2 (383-486)||(6765994-6766098)
chr2 (371-486)||(12938238-12938353)
chr2 (364-486)||(24204571-24204693)
chr2 (380-486)||(33677479-33677585)
chr2 (380-486)||(5963197-5963302)
chr2 (364-486)||(9864761-9864881)
chr2 (376-486)||(30421236-30421346)
chr2 (372-486)||(30830646-30830760)
chr2 (371-476)||(32010108-32010213)
chr2 (380-461)||(35115862-35115943)
chr2 (407-457)||(5280592-5280642)
chr2 (390-486)||(7645295-7645394)
chr2 (371-476)||(26998323-26998428)
chr2 (373-469)||(9709526-9709622)
chr2 (400-486)||(39696877-39696963)
chr2 (371-476)||(32273677-32273782)
chr2 (380-482)||(35022897-35023001)
chr2 (409-486)||(44454987-44455064)
chr2 (364-415)||(43415468-43415519)
chr2 (380-476)||(8032726-8032823)
chr2 (371-476)||(38071002-38071106)
chr2 (371-415)||(16494975-16495019)
chr2 (364-458)||(40808762-40808853)
chr2 (371-416)||(4891688-4891733)
chr2 (371-476)||(20380129-20380234)
chr2 (371-476)||(11030979-11031077)
chr2 (383-476)||(44442137-44442230)
[»] scaffold0300 (1 HSPs)
scaffold0300 (364-487)||(616-739)
[»] chr6 (20 HSPs)
chr6 (364-487)||(11082288-11082411)
chr6 (364-487)||(21542413-21542536)
chr6 (378-487)||(3095776-3095885)
chr6 (364-487)||(35129097-35129221)
chr6 (364-487)||(34177684-34177807)
chr6 (371-486)||(7274925-7275040)
chr6 (371-486)||(12461478-12461594)
chr6 (380-486)||(30794251-30794357)
chr6 (364-486)||(31107187-31107308)
chr6 (408-486)||(9428766-9428844)
chr6 (371-476)||(4987947-4988052)
chr6 (371-476)||(4031991-4032096)
chr6 (371-458)||(16013482-16013569)
chr6 (371-476)||(16524384-16524488)
chr6 (410-486)||(17751833-17751909)
chr6 (372-476)||(3888431-3888535)
chr6 (380-422)||(5300659-5300701)
chr6 (380-477)||(21963958-21964055)
chr6 (371-437)||(14573177-14573243)
chr6 (383-477)||(17598294-17598388)
[»] chr1 (75 HSPs)
chr1 (364-486)||(15959683-15959805)
chr1 (364-486)||(32624048-32624170)
chr1 (364-484)||(2126036-2126156)
chr1 (364-486)||(12449010-12449132)
chr1 (364-486)||(39555629-39555751)
chr1 (364-487)||(35691387-35691511)
chr1 (364-487)||(24190465-24190587)
chr1 (371-486)||(45226134-45226249)
chr1 (364-486)||(6785452-6785574)
chr1 (364-486)||(40718674-40718796)
chr1 (364-486)||(43667346-43667466)
chr1 (364-486)||(6786834-6786956)
chr1 (376-486)||(47600094-47600204)
chr1 (364-486)||(33369549-33369668)
chr1 (364-486)||(42965859-42965979)
chr1 (364-486)||(47014534-47014655)
chr1 (378-486)||(32983228-32983335)
chr1 (364-486)||(28016789-28016909)
chr1 (383-486)||(28120817-28120920)
chr1 (372-483)||(16854139-16854250)
chr1 (372-486)||(1820411-1820524)
chr1 (380-486)||(3076291-3076397)
chr1 (364-486)||(7468006-7468128)
chr1 (381-486)||(6787050-6787154)
chr1 (377-486)||(3875073-3875186)
chr1 (364-486)||(2246057-2246179)
chr1 (372-486)||(50369954-50370071)
chr1 (366-486)||(23392211-23392330)
chr1 (364-486)||(46542980-46543100)
chr1 (371-486)||(46818552-46818667)
chr1 (385-478)||(13136617-13136708)
chr1 (380-486)||(39932631-39932737)
chr1 (383-470)||(7876004-7876091)
chr1 (376-486)||(33431557-33431665)
chr1 (380-486)||(24728686-24728792)
chr1 (364-485)||(10558799-10558920)
chr1 (373-476)||(5858423-5858526)
chr1 (364-436)||(11241073-11241145)
chr1 (364-486)||(44148879-44148997)
chr1 (373-476)||(5950445-5950548)
chr1 (371-486)||(37735433-37735548)
chr1 (380-486)||(47302965-47303071)
chr1 (387-486)||(50012587-50012685)
chr1 (372-476)||(16688142-16688246)
chr1 (384-462)||(298732-298810)
chr1 (380-486)||(3861754-3861858)
chr1 (380-486)||(43765290-43765396)
chr1 (371-476)||(7397712-7397817)
chr1 (373-476)||(37538815-37538918)
chr1 (380-486)||(25391680-25391784)
chr1 (371-460)||(30701435-30701524)
chr1 (364-461)||(32742245-32742342)
chr1 (383-476)||(41063747-41063840)
chr1 (394-474)||(47026655-47026736)
chr1 (380-448)||(32318619-32318687)
chr1 (373-476)||(8889749-8889845)
chr1 (405-468)||(14086966-14087027)
chr1 (372-476)||(45840117-45840220)
chr1 (373-476)||(15912204-15912307)
chr1 (371-476)||(25185354-25185459)
chr1 (376-416)||(13351746-13351786)
chr1 (364-436)||(30221771-30221843)
chr1 (372-476)||(44510270-44510374)
chr1 (430-486)||(50665259-50665315)
chr1 (373-476)||(35366255-35366358)
chr1 (392-478)||(28916589-28916675)
chr1 (364-436)||(52984979-52985051)
chr1 (397-476)||(34102049-34102127)
chr1 (380-475)||(52841504-52841599)
chr1 (392-477)||(23873901-23873986)
chr1 (371-416)||(50176588-50176633)
chr1 (371-436)||(51338947-51339012)
chr1 (372-416)||(35884273-35884317)
chr1 (391-475)||(42724101-42724185)
chr1 (432-476)||(43359696-43359740)
[»] scaffold0774 (1 HSPs)
scaffold0774 (364-486)||(3471-3593)
[»] scaffold0045 (1 HSPs)
scaffold0045 (364-486)||(77953-78075)
[»] scaffold0018 (1 HSPs)
scaffold0018 (371-486)||(154857-154972)
[»] scaffold0442 (1 HSPs)
scaffold0442 (364-486)||(10041-10163)
[»] scaffold0062 (1 HSPs)
scaffold0062 (364-486)||(44814-44936)
[»] scaffold0132 (2 HSPs)
scaffold0132 (376-486)||(1008-1118)
scaffold0132 (376-486)||(8968-9078)
[»] scaffold0009 (2 HSPs)
scaffold0009 (364-486)||(157790-157912)
scaffold0009 (395-486)||(52676-52767)
[»] scaffold0111 (1 HSPs)
scaffold0111 (364-486)||(40175-40297)
[»] scaffold0012 (1 HSPs)
scaffold0012 (390-486)||(160246-160342)
[»] scaffold0565 (1 HSPs)
scaffold0565 (373-476)||(5927-6030)
[»] scaffold1786 (1 HSPs)
scaffold1786 (366-436)||(893-963)
[»] scaffold0010 (1 HSPs)
scaffold0010 (373-455)||(160971-161053)
[»] scaffold0005 (1 HSPs)
scaffold0005 (371-486)||(233538-233652)
[»] scaffold0330 (1 HSPs)
scaffold0330 (371-416)||(3234-3279)


Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 57)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 30864868 - 30865121
Alignment:
9 atttgcaatatattttgaactgatttgtatttgcagtcttcattatcatacctatctttctaatattattttattctttgttttcttagatggaaggatt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30864868 atttgcaatatattttgaactgatttgtatttgcagtcttcattatcatacctatctttctaatattattttattctttgttttcttagatggaaggatt 30864967  T
109 atgcaggagacaaaataaggcatgaaggccaaaacaaatatcagggagactagtttggagagctctgaaggataaattattggtgcttttttgaagatat 208  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30864968 atgcaggagacaaaataaggcatgaaggccaaaacaaatattagggaaactagtttggagagctctgaaggataaattattggtgcttttttgaagatat 30865067  T
209 catgtaaatatggtctaaaactatgttgaatactagaaaaataaaatttcgtgt 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30865068 catgtaaatatggtctaaaactatgttgaatactagaaaaataaaatttcgtgt 30865121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 364 - 487
Target Start/End: Complemental strand, 47867995 - 47867872
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
47867995 gtgttttctttggaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 47867896  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
47867895 tgcatttaattttatgagaataac 47867872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 20281707 - 20281585
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||     
20281707 gtgttttctttggaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaaaagaaaattgaatgtaatt 20281608  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
20281607 tgcatttaattttatgagaataa 20281585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 4058831 - 4058709
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||     
4058831 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggttattggttatggaaaaaatgaaagagagagaaaattgaatgaaatt 4058732  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
4058731 tgcatttaattttatgagaataa 4058709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 26916441 - 26916319
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||     
26916441 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaatttttattggctattggttatggaaaaaatgaaagaaaaataaaattgaatgtaatt 26916342  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
26916341 tgcatttaattttatgagaataa 26916319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 364 - 487
Target Start/End: Complemental strand, 2229363 - 2229240
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||     
2229363 gtgttttctttggaaaaagttttataggaagatgtaaaaacaatttttattggctattggttatggaaaaaatgaaagaaaaagaaaattgaatgtaatt 2229264  T
464 tgcatttaattttatgagaataac 487  Q
    |||||||||| |||||||||||||    
2229263 tgcatttaatattatgagaataac 2229240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 14332876 - 14332754
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| |||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||     
14332876 gtgttttctttggaaaaagttttataggaagatgtaaaaacaatttttattggccattggttatgaaaaaaatgaaagaaagagaaaattgaatgtaatt 14332777  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
14332776 tgcatttaattttatgagaataa 14332754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 383 - 486
Target Start/End: Complemental strand, 29203603 - 29203500
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgaga 482  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||    
29203603 ttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagagagagaaaattgaatgtaatttgcatttaattttatgaga 29203504  T
483 ataa 486  Q
    ||||    
29203503 ataa 29203500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 372 - 486
Target Start/End: Complemental strand, 20716288 - 20716174
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| ||||||||    
20716288 tttggaaaaagttttatagaaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagagtgagaaaattgaatgtaatttgcattta 20716189  T
472 attttatgagaataa 486  Q
    |||||||||||||||    
20716188 attttatgagaataa 20716174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 56318106 - 56318228
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| |||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||     
56318106 gtgttttctttggaaaaaggtttataggaagatgtaaaaacaattttcattagctattggttatggaaaaaatgaaagagagagaaaattgaatgtaatt 56318205  T
464 tgcatttaattttatgagaataa 486  Q
    | ||||||||||||||| |||||    
56318206 tacatttaattttatgataataa 56318228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 375 - 486
Target Start/End: Complemental strand, 10069802 - 10069691
Alignment:
375 gaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatt 474  Q
    |||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||  ||||||||||||| || |||||||||||    
10069802 gaaaaaagttttatagaaagatgtaaaaacaattttcattggctattggttatggaaaaagtgaaagaaaaggaaaattgaatgttatttgcatttaatt 10069703  T
475 ttatgagaataa 486  Q
    ||||||||||||    
10069702 ttatgagaataa 10069691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 5483314 - 5483436
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||| ||| |||||| ||||||||||||||||| ||||||||||||||| |||||||||| |||||| |||| ||||||||||||||||||||    
5483314 gtgttttctttaaaataagtttaataggaagatgtaaaaacaattttcattggctactggttatggagaaaatggaagagagagaaaattgaatgtaata 5483413  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||    
5483414 tgcatttaatttcatgagaataa 5483436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 39078272 - 39078151
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| |||||||||||||| |||||||||||| ||||||||||||||||| ||||| |||||||||||||| | |||||||||||||||||     
39078272 gtgttttctttggaaaaagttttatag-aagatgtaaaaacaattttcattggctattagttattgaaaaaatgaaagagaaagaaaattgaatgtaatg 39078174  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
39078173 tgcatttaattttatgagaataa 39078151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 41414647 - 41414768
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||| |||||||||||||| ||| |||||||||||||||     
41414647 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaatttttattggctattgattat-gaaaaaatgaaagagagaaaaaattgaatgtaatt 41414745  T
464 tgcatttaattttatgagaataa 486  Q
    ||||||||||||||| |||||||    
41414746 tgcatttaattttataagaataa 41414768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 365 - 486
Target Start/End: Complemental strand, 55580785 - 55580663
Alignment:
365 tgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaa-aaaatgaaagaaagagaaaattgaatgtaata 463  Q
    ||||| ||||| |||||||| |||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||| || ||||||||     
55580785 tgttttctttggaaaaagttgtataggaagatgtaaaaacaattttcattggctattagttatggaaaaaaatgaaagaaagagaaattttaatgtaatt 55580686  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
55580685 tgcatttaattttatgagaataa 55580663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 366 - 486
Target Start/End: Original strand, 17794579 - 17794699
Alignment:
366 gtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatg 465  Q
    |||| |||||||| || ||||||||||||||||||||| |||||||||||||||||| ||||||||||| || |||| ||||||||||||||||||| |     
17794579 gttttctttgaaataaattttataggaagatgtaaaaacaattttcattggctattgattatggaaaaattggaagagagagaaaattgaatgtaattta 17794678  T
466 catttaattttatgagaataa 486  Q
    |||||||||||||||||||||    
17794679 catttaattttatgagaataa 17794699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 364 - 462
Target Start/End: Complemental strand, 7654733 - 7654635
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaat 462  Q
    |||||| ||||| |||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
7654733 gtgttttctttggaaaaagttttataggaagatataaaaacaattttcattggctattgattatggaaaaaatgaaagaaagagaaaattgaatgtaat 7654635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 364 - 462
Target Start/End: Original strand, 16604882 - 16604980
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaat 462  Q
    |||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||    
16604882 gtgttttctttgaaaaaagttttataggaagatgttaaaacaattttcattggctattagttatggaaaaaatgaaagagagagaaaattgaatgtaat 16604980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 28669037 - 28669158
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||  |||| |||||||||||| ||||||||| |||||||||||| |||| |||||| ||||||||||||| |||||||||||||||||||     
28669037 gtgttttctttagaaaaggttttataggaaaatgtaaaaacaattttcattggttattagttatg-aaaaaatgaaagagagagaaaattgaatgtaatt 28669135  T
464 tgcatttaattttatgagaataa 486  Q
    || ||||||||||||||||||||    
28669136 tgtatttaattttatgagaataa 28669158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 371 - 480
Target Start/End: Complemental strand, 24940474 - 24940365
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| ||||||||||||| ||||||||||||| ||||||| |||| ||||||||||||| ||||||||||| |||||||||| |||||||| | |||||    
24940474 ctttggaaaaagttttataagaagatgtaaaaacaattttcgttggttattggttatggagaaaatgaaagagagagaaaattaaatgtaatttccattt 24940375  T
471 aattttatga 480  Q
    ||||||||||    
24940374 aattttatga 24940365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 397 - 486
Target Start/End: Original strand, 52535654 - 52535743
Alignment:
397 gtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||| |||| |||||||||||||||||||||||    
52535654 gtaaaaataattttcattggctattggttatagaaaaagtgaaagagagagaaaattgaatataatttgcatttaattttatgagaataa 52535743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 1585383 - 1585505
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||| |||||| || | ||||||| |||| |||||| ||||||||||| ||||||| |||||| |||| |||||||||||||||||||     
1585383 gtgttttctttgaaataagtttcatggaaagatgttaaaacaatttttattggctattgattatggagaaaatggaagagagagaaaattgaatgtaatt 1585482  T
464 tgcatttaattttatgagaataa 486  Q
    | |||||||||||||||||||||    
1585483 ttcatttaattttatgagaataa 1585505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 392 - 486
Target Start/End: Original strand, 35310806 - 35310900
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||| || ||||||||| ||||||||||    
35310806 aagatgtaaaaacaattttcattggctattggttatggaaaaaatggaagagagagaaaattaaatgtaatttgtatttaatttcatgagaataa 35310900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 392 - 486
Target Start/End: Complemental strand, 35529760 - 35529666
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||| |||||||||||| ||||||||||||||||||||||||| ||| ||||||||| ||||| |||||||||||||||||| ||||    
35529760 aagatgtaaaaacaattttcattgggtattggttatggaaaaaatgaaagagagataaaattgaaagtaatttgcatttaattttatgagcataa 35529666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 42915646 - 42915523
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaa-aaaatgaaagaaagagaaaattgaatgtaat 462  Q
    |||||| ||||| || |||||| || | |||||||||||| ||||||||||||| ||||||||||||| ||||| ||||| |||||||||| ||||||||    
42915646 gtgttttctttggaataagtttcatggaaagatgtaaaaacaattttcattggcaattggttatggaaaaaaataaaagagagagaaaattaaatgtaat 42915547  T
463 atgcatttaattttatgagaataa 486  Q
     |||||||||||| ||||||||||    
42915546 ttgcatttaatttcatgagaataa 42915523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 48793664 - 48793784
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || |||||| || |||||||||||||| ||||||||||||| |||||||||| ||||||| ||||  |||||||||| ||||||||     
48793664 gtgttttctttggaataagtttcatgggaagatgtaaaaacaattttcattggcaattggttatgaaaaaaataaaag--agagaaaattaaatgtaatt 48793761  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||    
48793762 tgcatttaatttcatgagaataa 48793784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 364 - 475
Target Start/End: Complemental strand, 5815585 - 5815474
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||| |||||||||  |||||||||||||||||||| |||| |||||| |||||||||||| | |||| |||||||||||||||||||     
5815585 gtgttttctttgaaataagttttatgagaagatgtaaaaataatttttattgactattgattatggaaaaaaaggaagagagagaaaattgaatgtaatt 5815486  T
464 tgcatttaattt 475  Q
      ||||||||||    
5815485 gacatttaattt 5815474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 373 - 476
Target Start/End: Original strand, 5841824 - 5841927
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| || |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||| ||||||| || | | |||||| ||    
5841824 ttgaaataaattttataggaagatgtaaaaataattttcattggttattggttattgaaaaaatgaaagagagagcaaattgattgcactttgcattgaa 5841923  T
473 tttt 476  Q
    ||||    
5841924 tttt 5841927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 8683342 - 8683462
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || |||||| || | || ||||||||||||||||||||||| |||||||||||||||||| ||||  |||||||||| ||||||||     
8683342 gtgttttctttggaataagtttcatggaaatatgtaaaaataattttcattggcaattggttatggaaaaaataaaag--agagaaaattaaatgtaatt 8683439  T
464 tgcatttaattttatgagaataa 486  Q
    || ||||||||| ||||||||||    
8683440 tgtatttaatttcatgagaataa 8683462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 383 - 442
Target Start/End: Original strand, 17186850 - 17186909
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaaga 442  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
17186850 ttttataggaagatgtaaaaataagtttcattggctattggttatggaaaaaatgaaaga 17186909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 46070565 - 46070668
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| |||||||||||| | |||||||| || ||||||||||  |||| |||||||||| | | |||||||    
46070565 ctttgaaataagttttataggaagatgtaaaaacaattttcattggttgttggttattgagaaaatgaaag--agagtaaattgaatgcactttgcattt 46070662  T
471 aatttt 476  Q
    ||||||    
46070663 aatttt 46070668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 8178282 - 8178387
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||| ||||||||||||| |||||  ||||| |||||||||| || ||||||||||| |||| |||||||||| | | |||||||    
8178282 ctttgaaataagttttataagaagatgtaaaaacaatttgtattggttattggttattgagaaaatgaaagagagagcaaattgaatgcactttgcattt 8178381  T
471 aatttt 476  Q
    ||||||    
8178382 aatttt 8178387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 392 - 486
Target Start/End: Original strand, 25297286 - 25297380
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||| |||||||||||||||||| ||||||| |||||  |||| |  |||||||||||||||| | |||||||||| ||||||||||    
25297286 aagatgtaaaaacaattttcattggctattgattatggagaaaatagaagagatggaaaattgaatgtaatttacatttaatttcatgagaataa 25297380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 371 - 485
Target Start/End: Complemental strand, 50145845 - 50145731
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| || ||||||||| |||||||||||| | |||||||||||||||||| | ||||| |||||| |||| || ||||||| ||||||||   |||||    
50145845 ctttggaataagttttatgggaagatgtaaacacaattttcattggctattgataatggagaaaatggaagagagggaaaattaaatgtaattaacattt 50145746  T
471 aattttatgagaata 485  Q
    ||||| |||| ||||    
50145745 aatttcatgaaaata 50145731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 364 - 475
Target Start/End: Complemental strand, 19351964 - 19351851
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgt-aaaaataattttcattggctattggttatggaaaaaatgaaagaaagag-aaaattgaatgtaa 461  Q
    |||||| | |||||| |||||| || ||||||||| ||||| ||||||||||||||||| |||||| ||| |||| || | |||| ||||||||||||||    
19351964 gtgttttcattgaaataagtttcatgggaagatgttaaaaacaattttcattggctattagttatgaaaacaatggaatagagagaaaaattgaatgtaa 19351865  T
462 tatgcatttaattt 475  Q
    | ||||||||||||    
19351864 tttgcatttaattt 19351851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 371 - 452
Target Start/End: Original strand, 47516234 - 47516315
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaat 452  Q
    |||||||| |||||||||||||||| ||||||| |||||||||||| | |||||||| || ||||||||||| |||| ||||    
47516234 ctttgaaataagttttataggaagaagtaaaaacaattttcattggttgttggttattgagaaaatgaaagagagagcaaat 47516315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 405 - 486
Target Start/End: Original strand, 50080528 - 50080609
Alignment:
405 aattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||| ||||||||||| ||||||| |||||| |||| || |||||||||||||||| |||||||||||| ||| ||||||    
50080528 aatttttattggctattgattatggataaaatggaagagagtgaaaattgaatgtaatttgcatttaatttcatgcgaataa 50080609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 476
Target Start/End: Original strand, 23978169 - 23978263
Alignment:
382 gttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    |||||||||||||||||||||| ||||||||||||   ||| |||| || ||||||||| | |||| |||||||||| | | |||||||||||||    
23978169 gttttataggaagatgtaaaaacaattttcattggtagttgattatagagaaaatgaaaaagagagcaaattgaatgcactttgcatttaatttt 23978263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 32323298 - 32323419
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||| ||| ||| ||||| |||||||||||||| ||||||||||| |  ||| |||| || |||||| |||| ||||||||||||| |||||     
32323298 gtgttttctttaaaataagatttatgggaagatgtaaaaacaattttcattgacgcttgattattgagaaaatggaagagagagaaaattgaa-gtaatt 32323396  T
464 tgcatttaattttatgagaataa 486  Q
    | |||||||||| |||| |||||    
32323397 tacatttaatttcatgataataa 32323419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 5064698 - 5064803
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||| ||||||||||||||| |||||||||| |   ||| |||| || ||||||||| | |||| |||||||||| | | |||||||    
5064698 ctttgaaataagttttaaaggaagatgtaaaaacaattttcattagtagttgattatagagaaaatgaaaaagagagtaaattgaatgcactttgcattt 5064797  T
471 aatttt 476  Q
    ||||||    
5064798 aatttt 5064803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 365 - 422
Target Start/End: Original strand, 21722719 - 21722776
Alignment:
365 tgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattg 422  Q
    ||||| ||||| || |||||||||||||||||||||||||||||||||||| ||||||    
21722719 tgttttctttgtaataagttttataggaagatgtaaaaataattttcattgactattg 21722776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 32410437 - 32410393
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattg 415  Q
    |||||||| ||||||||||||||||||||||||||||||||||||    
32410437 ctttgaaataagttttataggaagatgtaaaaataattttcattg 32410393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 14583837 - 14583723
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||| ||| |||||| || |||||||||||||| | |||||||||||||| | |||   | |||||| |||| || || ||||||||||||| |||||||    
14583837 ctttaaaataagtttcatgggaagatgtaaaaaca-ttttcattggctatggattaaaaagaaaatggaagagagtgataattgaatgtaatttgcattt 14583739  T
471 aattttatgagaataa 486  Q
    ||||| ||||||||||    
14583738 aatttcatgagaataa 14583723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 381 - 471
Target Start/End: Original strand, 17799187 - 17799277
Alignment:
381 agttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||||||| |||||||||||||| |||||||||||| |||| |||||||| ||||||| ||  |||  ||||| |||| ||| ||||||||    
17799187 agttttatgggaagatgtaaaaacaattttcattggttatttgttatggagaaaatgagagggagaacaaattaaatgcaatttgcattta 17799277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 371 - 474
Target Start/End: Complemental strand, 32203322 - 32203226
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| ||||||||| ||||||| |||||| ||||||||||||       ||||| ||||||||||| | ||||||||||||||||||  | |||||    
32203322 ctttgaaataagttttatgggaagatataaaaacaattttcattgg-------ttatgaaaaaaatgaaacatagagaaaattgaatgtaaattacattt 32203230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 371 - 416
Target Start/End: Complemental strand, 49080366 - 49080321
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattgg 416  Q
    |||||||| |||||||||||||||||||||||| ||||||||||||    
49080366 ctttgaaataagttttataggaagatgtaaaaacaattttcattgg 49080321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 380 - 475
Target Start/End: Complemental strand, 40553869 - 40553774
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattt 475  Q
    |||||| |||| |||||||||||| || ||||||||| |||| |||||||| ||| |||||   |||| ||| |||||| ||| ||||||||||||    
40553869 aagtttcatagaaagatgtaaaaacaagtttcattggttattagttatggagaaagtgaaaaggagagtaaaatgaatgcaatttgcatttaattt 40553774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 364 - 400
Target Start/End: Complemental strand, 16473864 - 16473828
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaa 400  Q
    |||||| ||||||||||||||||||||||||||||||    
16473864 gtgttttctttgaaaaaagttttataggaagatgtaa 16473828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 29511534 - 29511490
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattg 415  Q
    |||| ||| |||||||||||||||||||||||| |||||||||||    
29511534 ctttaaaataagttttataggaagatgtaaaaacaattttcattg 29511490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 395 - 486
Target Start/End: Complemental strand, 31280280 - 31280193
Alignment:
395 atgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||||||||||||||||| ||||||| | ||||| |||  ||||||||||||||| | | || ||||||||| || |||||||    
31280280 atgtaaaaataattttcattggctatt-gttatgg-agaaatggaag--agagaaaattgaatgcagtttgtatttaatttcattagaataa 31280193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 476
Target Start/End: Original strand, 8013134 - 8013237
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| |||||| |||| |||||||||||| |||||| ||||| |||| || || || ||||||||||| |||  | | |||||| ||  |||||||||    
8013134 ttgaaataagtttcatagaaagatgtaaaaacaatttttattggttattagtcatagagaaaatgaaagagagaacataatgaatgcaaattgcatttaa 8013233  T
473 tttt 476  Q
    ||||    
8013234 tttt 8013237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 436
Target Start/End: Complemental strand, 25268586 - 25268523
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaat 436  Q
    |||||| |||||| | | |||||  ||||||||||||||||||| ||||||||||||| |||||    
25268586 ttgaaataagtttcacaagaagaaataaaaataattttcattggttattggttatggagaaaat 25268523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 458
Target Start/End: Original strand, 28142665 - 28142752
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatg 458  Q
    |||| ||| ||||||||||||| |||||||||| ||||||||||||   ||| |||| || ||||||||| | |||| ||||| ||||    
28142665 ctttaaaataagttttataggaggatgtaaaaacaattttcattggtagttgattatagagaaaatgaaaaagagagcaaattaaatg 28142752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 445 - 486
Target Start/End: Original strand, 32280104 - 32280145
Alignment:
445 gagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||||||| |||||||| ||| ||||||||||    
32280104 gagaaaattgaatgtaatttgcatttagtttcatgagaataa 32280145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 371 - 476
Target Start/End: Complemental strand, 37911993 - 37911888
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||| ||| ||||||||||| || ||||||||| ||||||||||||   ||| |||| || ||||| ||| | |||| ||||| |||| | | |||||||    
37911993 ctttaaaataagttttatagaaatatgtaaaaacaattttcattggtagttgattatagagaaaataaaaaagagagcaaattcaatgcactttgcattt 37911894  T
471 aatttt 476  Q
    ||||||    
37911893 aatttt 37911888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 392 - 440
Target Start/End: Complemental strand, 8018468 - 8018420
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaa 440  Q
    ||||||||||||||||||||||||  ||||||||||  | |||||||||    
8018468 aagatgtaaaaataattttcattgattattggttataaataaaatgaaa 8018420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 384 - 416
Target Start/End: Original strand, 28318473 - 28318505
Alignment:
384 tttataggaagatgtaaaaataattttcattgg 416  Q
    |||||||||||||||||||| ||||||||||||    
28318473 tttataggaagatgtaaaaacaattttcattgg 28318505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 112; Significance: 2e-56; HSPs: 51)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 364 - 487
Target Start/End: Original strand, 7022447 - 7022570
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
7022447 gtgttttctttgaaaaaagttttataggaagatataaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 7022546  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
7022547 tgcatttaattttatgagaataac 7022570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 34890218 - 34890340
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||     
34890218 gtgttttctttggaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagagagagaaaattgaatgtaatt 34890317  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
34890318 tgcatttaattttatgagaataa 34890340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 36190888 - 36190766
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||     
36190888 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaataaaagagagagaaaattgaatgtaatt 36190789  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
36190788 tgcatttaattttatgagaataa 36190766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 364 - 487
Target Start/End: Complemental strand, 26483648 - 26483525
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
26483648 gtgttttctttgaaaaaagttttatagggagatgtaaaaacaattttcattggctattgattatggaaaaaatgaaagaaagagaaaattgaatgtaatt 26483549  T
464 tgcatttaattttatgagaataac 487  Q
    | |||||||||||| |||||||||    
26483548 tacatttaattttacgagaataac 26483525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 31734231 - 31734109
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||     
31734231 gtgttttctttgaaaaaagttttataggaagatataaaaacaattttcattggctattggatatggaaaaaatgaaagagagagaaaattgaatgtaatt 31734132  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||    
31734131 tgcatttaatttgatgagaataa 31734109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 372 - 486
Target Start/End: Complemental strand, 8711985 - 8711870
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||    
8711985 tttggaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaattaaagagagagaaaattgaatgtaatttgcattta 8711886  T
472 a-ttttatgagaataa 486  Q
    | ||||||||||||||    
8711885 atttttatgagaataa 8711870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 372 - 486
Target Start/End: Complemental strand, 7858636 - 7858522
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||||||||||||||||||||||||||||||| ||||||||||| | |||| ||||||||||||||||||| ||||||||||||| ||||| ||||||||    
7858636 tttgaaaaaagttttataggaagatgtaaaaacaattttcattgaccattgattatggaaaaaatgaaagagagagaaaattgaaagtaatttgcattta 7858537  T
472 attttatgagaataa 486  Q
    |||||||||||||||    
7858536 attttatgagaataa 7858522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 43216391 - 43216513
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| ||||||||||  |||||||||||||| ||||||||||| ||| |||||| ||||||||     
43216391 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattcactattggttatggagaaaatgaaagagagataaaattaaatgtaatt 43216490  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
43216491 tgcatttaattttatgagaataa 43216513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 15957955 - 15958079
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaa--agaaagagaaaattgaatgtaa 461  Q
    |||||| ||||||||||||||||||||||| | ||||||| |||||||||| ||||||||||||||||||||||||  ||| ||||||||||||||||||    
15957955 gtgttttctttgaaaaaagttttataggaataagtaaaaacaattttcatttgctattggttatggaaaaaatgaaagagagagagaaaattgaatgtaa 15958054  T
462 tatgcatttaattttatgagaataa 486  Q
    | |||||||||||||||||||||||    
15958055 tttgcatttaattttatgagaataa 15958079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 28348719 - 28348605
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| ||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||    
28348719 ctttggaaaaagttttataggaatatgtaaaaacaatttccattggctattggttatggaaaaa-tgaaagagagagaaaattgaatgtaatttgcattt 28348621  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
28348620 aattttatgagaataa 28348605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 13143880 - 13143758
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| | ||||||||||||| ||||||||||||||||| |||||||||||||| |||||| ||| |||||||||||| ||| |||||||||||||||     
13143880 gtgttttcgttgaaaaaagtttcataggaagatgtaaaaacaattttcattggctgttggttgtgggaaaaatgaaagagagaaaaaattgaatgtaatt 13143781  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
13143780 tgcatttaattttatgagaataa 13143758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 41086430 - 41086552
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||||||||||  |||||||||||| |||||||||||||||||||| ||||||||||| ||| | |||||||||| ||||||||     
41086430 gtgttttctttgaaaaaagttttatataaagatgtaaaaacaattttcattggctattggtaatggaaaaaataaaacagagagaaaattcaatgtaatt 41086529  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
41086530 tgcatttaattttatgagaataa 41086552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 376 - 486
Target Start/End: Original strand, 34158347 - 34158457
Alignment:
376 aaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattt 475  Q
    |||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||  ||||| ||||||||||||||||||| ||||||||||||    
34158347 aaaaaagttttataggaagatgtaaaaacaattttcattgactattggttatgaaaaaaacaaaagagagagaaaattgaatgtaatttgcatttaattt 34158446  T
476 tatgagaataa 486  Q
    ||||| |||||    
34158447 tatgataataa 34158457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 371 - 486
Target Start/End: Original strand, 8107669 - 8107783
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||||||||||||||| |  | |||||||||| |||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||| |||||||    
8107669 ctttgaaaaaagttttacaatatgatgtaaaaacaattttcattggctattggttatggataaa-tgaaagagagagaaaattgaatgtaatttgcattt 8107767  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
8107768 aattttatgagaataa 8107783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 24892957 - 24892832
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaa---aaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgta 460  Q
    |||||| ||||| |||| ||||||||||| ||| |||   ||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||    
24892957 gtgttttctttggaaaacgttttataggaggatataataaaaacaattttcattggctattggttatggaaaaaatgaaagagatagaaaattgaatgta 24892858  T
461 atatgcatttaattttatgagaataa 486  Q
    || |||||||||||||||||||||||    
24892857 atttgcatttaattttatgagaataa 24892832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 377 - 486
Target Start/End: Original strand, 35456081 - 35456190
Alignment:
377 aaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    |||||||||||||| |||||||||||| |||||||||||||||||  ||||||||||||| ||||| |||||||| |||||||||| | |||||||||||    
35456081 aaaaagttttatagaaagatgtaaaaacaattttcattggctattaattatggaaaaaataaaagagagagaaaaatgaatgtaatttacatttaatttt 35456180  T
477 atgagaataa 486  Q
    ||||||||||    
35456181 atgagaataa 35456190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 391 - 486
Target Start/End: Complemental strand, 7499816 - 7499720
Alignment:
391 gaagatgtaaaaataattttcattggctattggttatggaaaaaa-tgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| | |||||||||||||||||||||    
7499816 gaagatgtaaaaacaattttcattggctattggttatggaaaaaaatgaaagagagagaaaattgaatgtaatttacatttaattttatgagaataa 7499720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 364 - 462
Target Start/End: Complemental strand, 35525703 - 35525605
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaat 462  Q
    |||||| ||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||| ||||| |||||||||| ||||||||    
35525703 gtgttttctttgaaaaaagttttacaggaagatgtaaaaacaattttcattgactattggttatggaaaaaataaaagagagagaaaatttaatgtaat 35525605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 389 - 481
Target Start/End: Original strand, 3642039 - 3642130
Alignment:
389 aggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgag 481  Q
    ||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||    
3642039 aggaagatgtaaaaacaatttt-attggctattggttatggaaaaaatgaaagagagagaaaattgaatgtaatttgcattttattttatgag 3642130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 395 - 486
Target Start/End: Original strand, 4046969 - 4047060
Alignment:
395 atgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||| |||||||| |||||||||||| ||||||||||    
4046969 atgtaaaaataattttcattggcaattggttatggaaaaaataaaagagagagaaaattaaatgtaatttgcatttaatttcatgagaataa 4047060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 364 - 472
Target Start/End: Original strand, 30575878 - 30575987
Alignment:
364 gtgtttcctttgaaaaaagtttt-ataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaat 462  Q
    |||||| |||| ||||||||||| | ||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| || |||||    
30575878 gtgttttctttaaaaaaagtttttacaggaaaatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagagagagaaaattaaaagtaat 30575977  T
463 atgcatttaa 472  Q
     |||||||||    
30575978 ttgcatttaa 30575987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 376 - 486
Target Start/End: Complemental strand, 2052938 - 2052830
Alignment:
376 aaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattt 475  Q
    ||||||||||||| |||||||||||||| ||||||||||||||||||| || ||| |||||  |||  ||||||||||||||||||| ||||||||||||    
2052938 aaaaaagttttatgggaagatgtaaaaacaattttcattggctattggctagggagaaaatagaag--agagaaaattgaatgtaatttgcatttaattt 2052841  T
476 tatgagaataa 486  Q
     ||||||||||    
2052840 catgagaataa 2052830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 373 - 476
Target Start/End: Complemental strand, 17713330 - 17713227
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| ||||||||||||||||| |||||| |||||||||||| |||||||||| ||||||||| |||| |||| | |||||||| | | |||||||||    
17713330 ttgaaataagttttataggaagatttaaaaacaattttcattggttattggttattgaaaaaatggaagagagagcacattgaatgcactttgcatttaa 17713231  T
473 tttt 476  Q
    ||||    
17713230 tttt 17713227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 371 - 486
Target Start/End: Original strand, 29920319 - 29920434
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| || |||||| || |||||||||||||| |||||||||||||||||| ||||||| |||||  |||| || ||||||||||||||||  | ||||    
29920319 ctttggaataagtttcatgggaagatgtaaaaacaattttcattggctattgattatggacaaaatagaagagagggaaaattgaatgtaattggtattt 29920418  T
471 aattttatgagaataa 486  Q
    ||||| ||||||||||    
29920419 aatttcatgagaataa 29920434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 380 - 457
Target Start/End: Original strand, 2628224 - 2628301
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaat 457  Q
    ||||||||||||||||||||||||||||||||||||| ||||| |||| || ||||||||||| |||| |||||||||    
2628224 aagttttataggaagatgtaaaaataattttcattggttattgcttattgagaaaatgaaagagagagcaaattgaat 2628301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 26954443 - 26954548
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| |||||||||||| | |||||||| || ||||||||||| | || ||| |||||| | | |||||||    
26954443 ctttgaaataagttttataggaagatgtaaaaacaattttcattggttgttggttattgagaaaatgaaagagaaagcaaaatgaatgcactttgcattt 26954542  T
471 aatttt 476  Q
    ||||||    
26954543 aatttt 26954548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 8709830 - 8709950
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||| |||| | || |||||| ||||||| | ||||||||| ||||  |||||||| |||||  ||||  ||||||||||||||||||     
8709830 gtgttttctttgaaataagtctcatgggaagaagtaaaaacatttttcattgactatatgttatggagaaaatagaaga--gagaaaattgaatgtaatt 8709927  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
8709928 tgcatttaattttatgagaataa 8709950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 367 - 486
Target Start/End: Complemental strand, 41756038 - 41755920
Alignment:
367 tttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgc 466  Q
    |||| ||||||| || |||||||| || ||||||||||||| |||||||  ||||| ||||||||||| ||||||| ||| ||||||||||||||| | |    
41756038 tttcttttgaaataaattttatagaaaaatgtaaaaataatgttcattgattattgcttatggaaaaa-tgaaagagagaaaaaattgaatgtaatttac 41755940  T
467 atttaattttatgagaataa 486  Q
    ||||||||| |||| |||||    
41755939 atttaatttcatgataataa 41755920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 16879436 - 16879558
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||| || ||| || |||| ||||||||| |||||| |||| |||||| ||||||  ||||||||||| ||||||||||||||||| |     
16879436 gtgttttctttgaaataaatttcatgggaatatgtaaaaacaatttttattgactattgattatggtgaaaatgaaagagagagaaaattgaatgtagtt 16879535  T
464 tgcatttaattttatgagaataa 486  Q
    || ||||||||| || |||||||    
16879536 tgtatttaatttcataagaataa 16879558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 364 - 448
Target Start/End: Original strand, 13143989 - 13144073
Alignment:
364 gtgtttcctttgaaaa-aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagaga 448  Q
    |||||| ||||||||| |||||||||||||||||||||||| |||||||||| | |||||||||||| |||||||||||| |||||    
13143989 gtgttttctttgaaaaaaagttttataggaagatgtaaaaacaattttcattagttattggttatgg-aaaaatgaaagagagaga 13144073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 372 - 476
Target Start/End: Complemental strand, 8673489 - 8673385
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    ||||||| |||||||||| ||||||||||||| ||||||||||||   ||| |||| || ||||||||| | |||| |||||||||||| | ||||||||    
8673489 tttgaaataagttttataagaagatgtaaaaacaattttcattggtagttgattatagagaaaatgaaaaagagagcaaattgaatgtactttgcattta 8673390  T
472 atttt 476  Q
    |||||    
8673389 atttt 8673385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 412 - 486
Target Start/End: Original strand, 15824723 - 15824797
Alignment:
412 attggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||||||| |||||||| |||| |||||||||| |||||||| | |||||||||| ||||||||||    
15824723 attggctattggttatgaaaaaaatggaagagagagaaaatttaatgtaattttcatttaatttcatgagaataa 15824797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 449
Target Start/End: Original strand, 16358168 - 16358240
Alignment:
377 aaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaa 449  Q
    ||||||||| ||||||||||||||||  ||||||||||| |||||| ||||| ||||||||||||| ||||||    
16358168 aaaaagtttcataggaagatgtaaaatcaattttcattgactattgattatgaaaaaaatgaaagagagagaa 16358240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 373 - 476
Target Start/End: Complemental strand, 8745690 - 8745587
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| |||||||||||||||||||||||| |||||||||||| | ||| |||| |||||||| ||||  |||| ||||| ||  || | |||||||||    
8745690 ttgaaataagttttataggaagatgtaaaaacaattttcattggttgttgattatagaaaaaataaaagggagagcaaattaaaaatagtttgcatttaa 8745591  T
473 tttt 476  Q
    ||||    
8745590 tttt 8745587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 476
Target Start/End: Original strand, 25195109 - 25195202
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    ||||||||||||||||||||| ||||||||||||   ||| |||| || ||||||||| | |||| |||||||||| | | |||||||||||||    
25195109 ttttataggaagatgtaaaaacaattttcattggtggttgattatagagaaaatgaaaaagagagcaaattgaatgcactttgcatttaatttt 25195202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 41362358 - 41362463
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| ||||||||||||   ||| |||| || ||||||||| |  ||| ||||| |||| | | |||||||    
41362358 ctttgaaataagttttataggaagatgtaaaaacaattttcattggtagttgattatagagaaaatgaaaaagtgagcaaattaaatgcactttgcattt 41362457  T
471 aatttt 476  Q
    ||||||    
41362458 aatttt 41362463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 381 - 476
Target Start/End: Original strand, 14576213 - 14576301
Alignment:
381 agttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    |||||||||| ||||||||||||||||||||       ||||||||| || ||||||||||| |||| |||||||||| | | |||||||||||||    
14576213 agttttatagaaagatgtaaaaataattttc-------attggttattgagaaaatgaaagagagagcaaattgaatgcactttgcatttaatttt 14576301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 371 - 476
Target Start/End: Complemental strand, 17336851 - 17336746
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| || ||||||||||||||||||||| ||||||||||||   ||| |||| ||  ||||||||   |||| |||||||||| | | |||||||    
17336851 ctttgaaataaattttataggaagatgtaaaaacaattttcattggtagttgattatagagtaaatgaaaaggagagcaaattgaatgcactttgcattt 17336752  T
471 aatttt 476  Q
    ||||||    
17336751 aatttt 17336746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 372 - 476
Target Start/End: Original strand, 4038933 - 4039037
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    ||||||| |||||||||| ||||||||||||| |||||||||| |   ||| |||| || ||||||||| | |||| |||||||||| | | | ||||||    
4038933 tttgaaataagttttatatgaagatgtaaaaacaattttcatttgtagttgattatagagaaaatgaaaaagagagcaaattgaatgcactttacattta 4039032  T
472 atttt 476  Q
    |||||    
4039033 atttt 4039037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 364 - 440
Target Start/End: Original strand, 44663833 - 44663909
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaa 440  Q
    |||||| ||||| || || |||||| | ||||||||||||||||||| ||||||||||| ||| ||| |||||||||    
44663833 gtgttttctttggaataaattttatggaaagatgtaaaaataatttttattggctattgattagggacaaaatgaaa 44663909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 373 - 475
Target Start/End: Complemental strand, 5217499 - 5217397
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| |||||| |||| |||||||||||| |||||| ||||| |||| ||||| || ||||||||||| | || | | |||||| ||  |||||||||    
5217499 ttgaaataagtttcatagaaagatgtaaaaacaatttttattggttattagttatagagaaaatgaaagagaaagcataatgaatgcaaattgcatttaa 5217400  T
473 ttt 475  Q
    |||    
5217399 ttt 5217397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 444 - 486
Target Start/End: Original strand, 13144085 - 13144127
Alignment:
444 agagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||||||||| ||||||||||||||||| |||||    
13144085 agagaaaattgaatgtaatttgcatttaattttatgaaaataa 13144127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 373 - 435
Target Start/End: Original strand, 28497191 - 28497253
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaa 435  Q
    |||||| ||||||||| |||||||||||||| ||||||||||   |||||||||| |||||||    
28497191 ttgaaataagttttatgggaagatgtaaaaacaattttcattacttattggttattgaaaaaa 28497253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 380 - 477
Target Start/End: Complemental strand, 39187334 - 39187237
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    ||||||||| | ||||||||||||||||||||||||| ||    ||||||| ||||| |||   |||  |||||||||| ||| ||||||||||||||    
39187334 aagttttatggaaagatgtaaaaataattttcattggttaaaaattatggagaaaataaaaaggagaacaaattgaatgcaatttgcatttaatttta 39187237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 407 - 471
Target Start/End: Complemental strand, 7670813 - 7670749
Alignment:
407 ttttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||||||| |||||| |||||||| |||||| || | ||||||||||||||||||| | ||||||    
7670813 ttttcatttgctattagttatggagaaaatggaatagagagaaaattgaatgtaattttcattta 7670749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 380 - 476
Target Start/End: Complemental strand, 27819759 - 27819663
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    ||||||||||  |||||||||||| | |||| ||||  |||||||||| || ||||| ||||  |||| ||||| |||||| | |||||||||||||    
27819759 aagttttatataaagatgtaaaaacattttttattgattattggttatagagaaaataaaagggagagcaaattaaatgtagtttgcatttaatttt 27819663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 380 - 486
Target Start/End: Original strand, 33563571 - 33563681
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggc--tattggttatggaaaaaatg--aaagaaagagaaaattgaatgtaatatgcatttaattt 475  Q
    ||||||||| |||||||||||||| ||||||||||| |  | ||||||||| | ||||||   |||| |||| | |||||||||||| | | ||||||||    
33563571 aagttttatgggaagatgtaaaaacaattttcattgaccattttggttatgcagaaaatggagaagagagaggagattgaatgtaatttacgtttaattt 33563670  T
476 tatgagaataa 486  Q
     ||||||||||    
33563671 catgagaataa 33563681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 414
Target Start/End: Complemental strand, 4480884 - 4480841
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcatt 414  Q
    |||| ||| ||||||||| |||||||||||||||||||||||||    
4480884 ctttaaaataagttttattggaagatgtaaaaataattttcatt 4480841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 458
Target Start/End: Complemental strand, 38072272 - 38072185
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatg 458  Q
    |||||||  ||||||||||  || ||||||||| ||||||||||||   ||| |||| || ||||||||| |||||| ||||||||||    
38072272 ctttgaattaagttttataaaaaaatgtaaaaacaattttcattggtagttgattatagagaaaatgaaaaaaagagcaaattgaatg 38072185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 392 - 477
Target Start/End: Original strand, 31133101 - 31133186
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    ||||||||||||||||| ||||||| ||    ||||||| ||||| |||   ||| ||||||||||| ||| ||||||||||||||    
31133101 aagatgtaaaaataattctcattggttaaaaattatggagaaaataaaaaggagaaaaaattgaatgcaatttgcatttaatttta 31133186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 14693478 - 14693434
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattg 415  Q
    |||||||| || ||||||| ||||||||||||| |||||||||||    
14693478 ctttgaaataaattttataagaagatgtaaaaacaattttcattg 14693434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 112; Significance: 2e-56; HSPs: 45)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 364 - 487
Target Start/End: Complemental strand, 45486073 - 45485950
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
45486073 gtgttttctttggaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 45485974  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
45485973 tgcatttaattttatgagaataac 45485950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 364 - 487
Target Start/End: Original strand, 25737669 - 25737792
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
25737669 gtgttttctttggaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 25737768  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
25737769 tgcatttaattttatgagaataac 25737792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 364 - 487
Target Start/End: Original strand, 46760299 - 46760422
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||     
46760299 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaatattgaatgtaatt 46760398  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
46760399 tgcatttaattttatgagaataac 46760422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 364 - 487
Target Start/End: Complemental strand, 35923370 - 35923247
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
35923370 gtgttttctttggaaaaagttttatagaaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 35923271  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
35923270 tgcatttaattttatgagaataac 35923247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 377 - 487
Target Start/End: Complemental strand, 14805975 - 14805865
Alignment:
377 aaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
14805975 aaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatttgcatttaatttt 14805876  T
477 atgagaataac 487  Q
    |||||||||||    
14805875 atgagaataac 14805865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 377 - 487
Target Start/End: Complemental strand, 15252969 - 15252859
Alignment:
377 aaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
15252969 aaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatttgcatttaatttt 15252870  T
477 atgagaataac 487  Q
    |||||||||||    
15252869 atgagaataac 15252859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 18102648 - 18102526
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||     
18102648 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggccattggttatggaaaaaatgaaagagagtgaaaattgaatgtaatt 18102549  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
18102548 tgcatttaattttatgagaataa 18102526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 25944694 - 25944572
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||     
25944694 gtgttttctttggaaaaagttttataggaagatgtaaaaacaattttcattggccattggttatggaaaaaataaaagagagagaaaattgaatgtaatt 25944595  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
25944594 tgcatttaattttatgagaataa 25944572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 364 - 487
Target Start/End: Original strand, 19912811 - 19912934
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| |||||||||||||| || ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||     
19912811 gtgttttctttggaaaaagttttatagtaaaatgtaaaaacaattttcattggttattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 19912910  T
464 tgcatttaattttatgagaataac 487  Q
    |||||||||||| |||||||||||    
19912911 tgcatttaatttcatgagaataac 19912934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 4910675 - 4910797
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||  |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||     
4910675 gtgttttctttagaaaaagttttataggaagatgtaaaaataattttcattggctattgattatggaaaaaatgaaagagagataaaattgaatgtaatt 4910774  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||| ||||    
4910775 tgcatttaattttatgagcataa 4910797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 371 - 486
Target Start/End: Original strand, 20123729 - 20123844
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| |||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||| |||||||    
20123729 ctttggaaaaagttttatagcaagatgtaaaaacaattttcattggctattgcttatggaaaaaatgaaagagaaagaaaattgaatgtaatttgcattt 20123828  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
20123829 aattttatgagaataa 20123844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 6191163 - 6191041
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||| |||||| ||||||||     
6191163 gtgttttcttttaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggagaaaatgaaagagagataaaattaaatgtaatt 6191064  T
464 tgcatttaattttatgagaataa 486  Q
    | |||||||||||||||||||||    
6191063 ttcatttaattttatgagaataa 6191041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 22632207 - 22632085
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||| |||||| || |||||||||||||| |||||||||||| |||||||||||||||||||| |||| |||||||||| ||||||||     
22632207 gtgttttctttgaaataagtttcatgggaagatgtaaaaacaattttcattggatattggttatggaaaaaatggaagagagagaaaattaaatgtaatt 22632108  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||    
22632107 tgcatttaatttcatgagaataa 22632085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 384 - 486
Target Start/End: Original strand, 47557663 - 47557765
Alignment:
384 tttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaa 483  Q
    |||||||||||||||||||| |||||||||||||||||  ||||||||||||||||||| | |||||||| |||||||| ||||||||||| ||||||||    
47557663 tttataggaagatgtaaaaacaattttcattggctattaattatggaaaaaatgaaagagaaagaaaattaaatgtaatttgcatttaattctatgagaa 47557762  T
484 taa 486  Q
    |||    
47557763 taa 47557765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 380 - 486
Target Start/End: Complemental strand, 47779706 - 47779600
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    |||||| || |||||||||||||| ||||||||||||| | |||||||||||||||| |||||||||||||||| |||||||| |||||||||||| |||    
47779706 aagtttcatgggaagatgtaaaaacaattttcattggcaactggttatggaaaaaataaaagaaagagaaaattaaatgtaatttgcatttaatttcatg 47779607  T
480 agaataa 486  Q
    |||||||    
47779606 agaataa 47779600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 376 - 486
Target Start/End: Complemental strand, 9158195 - 9158086
Alignment:
376 aaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattt 475  Q
    |||||||||||||||||||||||||||| ||||||| ||||| ||||||||| |||||||||||||| | | ||| ||||||||||| ||||||||||||    
9158195 aaaaaagttttataggaagatgtaaaaacaattttctttggccattggttat-gaaaaaatgaaagagaaaaaaatttgaatgtaatttgcatttaattt 9158097  T
476 tatgagaataa 486  Q
    ||| |||||||    
9158096 tataagaataa 9158086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 11780135 - 11780014
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||| ||| || |||||| |||||||||||||||||||| ||||| |||||  ||||| | |||||| |||||||||||||||  |||||||     
11780135 gtgttttctttaaaataaattttattggaagatgtaaaaataattt-cattgactatttcttatgaagaaaatggaagaaagagaaaatttgatgtaatt 11780037  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
11780036 tgcatttaattttatgagaataa 11780014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 380 - 486
Target Start/End: Complemental strand, 14574666 - 14574560
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    |||||| || |||||||||||||||||||| ||||| |||||||||||| | |||||| |||| || ||||||||| | |||| ||||||||||||||||    
14574666 aagtttcatgggaagatgtaaaaataatttccattgtctattggttatgaagaaaatggaagagagtgaaaattgattttaatttgcatttaattttatg 14574567  T
480 agaataa 486  Q
    |||||||    
14574566 agaataa 14574560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 365 - 448
Target Start/End: Original strand, 12632387 - 12632470
Alignment:
365 tgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagaga 448  Q
    ||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||| | |||||||||| ||||| |||||    
12632387 tgttttctttgaaaaaagtttcataggaagatgtaaaaacaattttcattggctattggctgtggaaaaaataaaagagagaga 12632470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 392 - 486
Target Start/End: Complemental strand, 15995809 - 15995715
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||||||| |||||| ||||||||||| | |||||| |||| || ||||||||| | |||| |||||||||||||||||||||||    
15995809 aagatgtaaaaataatttccattggttattggttatgaagaaaatggaagagagtgaaaattgattttaatttgcatttaattttatgagaataa 15995715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 384 - 486
Target Start/End: Original strand, 2610630 - 2610732
Alignment:
384 tttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaaga-aagagaaaattgaatgtaatatgcatttaattttatgaga 482  Q
    ||||||| |||||||||||| | ||||| |||||||||||||||||| |||||| |||| |||| ||||||||||||||| |||| ||||||| ||||||    
2610630 tttatagaaagatgtaaaaacatttttctttggctattggttatggagaaaatggaagagaaga-aaaattgaatgtaatttgcacttaatttcatgaga 2610728  T
483 ataa 486  Q
    ||||    
2610729 ataa 2610732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 391 - 486
Target Start/End: Complemental strand, 44682968 - 44682874
Alignment:
391 gaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||| ||||||||||| ||||||||||||| | |||||||||| | ||||||||| ||||||| |||| ||||||| ||||||||||    
44682968 gaagatgtaaaaacaattttcattgactattggttatgg-agaaatgaaagatatagaaaattggatgtaatttgcaattaatttcatgagaataa 44682874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 427
Target Start/End: Original strand, 35068891 - 35068954
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttat 427  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||    
35068891 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttaattagctattggttat 35068954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 373 - 476
Target Start/End: Complemental strand, 38260425 - 38260322
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| ||||||||||| ||| ||||||||||||||||||||| ||||  |||| || ||||||||||| |||| ||||| |||| | | |||||||||    
38260425 ttgaaataagttttatagaaagttgtaaaaataattttcattggttatttattattgagaaaatgaaagagagagcaaattaaatgcactttgcatttaa 38260326  T
473 tttt 476  Q
    ||||    
38260325 tttt 38260322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 376 - 442
Target Start/End: Complemental strand, 4069109 - 4069043
Alignment:
376 aaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaaga 442  Q
    ||||||||||||||| |||||||||||| |||||||||||| ||||||||||||| |||||| ||||    
4069109 aaaaaagttttatagaaagatgtaaaaagaattttcattggttattggttatggagaaaatggaaga 4069043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 391 - 487
Target Start/End: Original strand, 4237784 - 4237880
Alignment:
391 gaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataac 487  Q
    |||||||||||||||||||| ||||||||||| ||| | | |||||| |||| | | | |||||||| |||| ||||||||||||||| ||||||||    
4237784 gaagatgtaaaaataattttaattggctattgattaggaagaaaatggaagagaaatataattgaatataatttgcatttaattttattagaataac 4237880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 380 - 475
Target Start/End: Original strand, 24151640 - 24151734
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattt 475  Q
    |||||||||||||||||||||||| |||||||| ||  |||||||||| || |||| |||||| |||| |||||||||||| | ||||| ||||||    
24151640 aagttttataggaagatgtaaaaacaattttcactgattattggttattgagaaaa-gaaagagagagcaaattgaatgtactttgcatgtaattt 24151734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 373 - 476
Target Start/End: Complemental strand, 39170643 - 39170540
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| |||||||||| ||||||||||||| |||||||||| |  |||| |||| || ||||||||||| | || |||||||||| | | |||||||||    
39170643 ttgaaataagttttatacgaagatgtaaaaacaattttcatttgtcattgattattgagaaaatgaaagagatagcaaattgaatgcactttgcatttaa 39170544  T
473 tttt 476  Q
    ||||    
39170543 tttt 39170540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 391 - 485
Target Start/End: Original strand, 27810804 - 27810898
Alignment:
391 gaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaata 485  Q
    ||||||||||||| |||||| ||||| ||||| ||||  | |||||| |||| |  |||||||||||||||| |||||||||||| |||||||||    
27810804 gaagatgtaaaaacaatttttattggttattgattatatagaaaatggaagagatggaaaattgaatgtaatttgcatttaatttcatgagaata 27810898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 461
Target Start/End: Original strand, 31549964 - 31550042
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaa 461  Q
    ||||||||||||||||||||| || |||||||| | ||||||||||| ||||| |  ||||| ||||||||||||||||    
31549964 ttttataggaagatgtaaaaacaactttcattgacaattggttatgggaaaaaggggagaaaaagaaaattgaatgtaa 31550042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 380 - 480
Target Start/End: Complemental strand, 48413820 - 48413723
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    |||||||||  ||||||| ||||| ||||||||||| |||||||||||||| |||||  |||  |||||||||||||| |||| |||||||||||| |||    
48413820 aagttttatgagaagatgcaaaaacaattttcattgactattggttatggagaaaatagaag--agagaaaattgaat-taatttgcatttaatttcatg 48413724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 16917582 - 16917468
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| || |||||| || |||||||||||||| ||||||||||  ||||||||||| |  ||||||  | | ||||||||||||| ||||| |||||||    
16917582 ctttggaataagtttcatgggaagatgtaaaaacaattttcattaactattggttat-gtgaaaatgggaaatagagaaaattgaaagtaatttgcattt 16917484  T
471 aattttatgagaataa 486  Q
    ||||| |||| |||||    
16917483 aatttaatgaaaataa 16917468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 381 - 458
Target Start/End: Original strand, 8015732 - 8015807
Alignment:
381 agttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatg 458  Q
    ||||||||| ||||||||||||| |||||| ||||| ||||| |||| ||||||||| |||  |||||||||||||||    
8015732 agttttataagaagatgtaaaaacaatttttattggttattgattatagaaaaaatgcaag--agagaaaattgaatg 8015807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 445 - 486
Target Start/End: Original strand, 12633110 - 12633151
Alignment:
445 gagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||||||| |||||||||||||||||||||||    
12633110 gagaaaattgaatgtaatttgcatttaattttatgagaataa 12633151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 31769011 - 31769116
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| |||||||||||    ||| |||| || ||||| |||   |||| |||||||||| | | |||||||    
31769011 ctttgaaataagttttataggaagatgtaaaaacaattttcattgatagttgattatagagaaaataaaaatgagagcaaattgaatgcactttgcattt 31769110  T
471 aatttt 476  Q
    ||||||    
31769111 aatttt 31769116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 392 - 477
Target Start/End: Original strand, 21654150 - 21654235
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    ||||||||||||||||| ||||||| ||    ||||||| |||||||||   |||  |||||||||||||| ||||||||||||||    
21654150 aagatgtaaaaataattctcattggttaaaaattatggagaaaatgaaaaggagaacaaattgaatgtaatttgcatttaatttta 21654235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 35888018 - 35888123
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| || ||||||||||||||||||||| |||||||||| |   ||| |||| || ||||| ||| | |||| |||||||||| | | |||||||    
35888018 ctttgaaataacttttataggaagatgtaaaaacaattttcattagtagttgattatagagaaaataaaaaagagagcaaattgaatgcactttgcattt 35888117  T
471 aatttt 476  Q
     |||||    
35888118 tatttt 35888123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 380 - 477
Target Start/End: Complemental strand, 48879485 - 48879388
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    ||||||||||| ||||||||||||||||| ||||||| ||    ||||||| ||||| |||   |||  |||||||||| ||| ||||||||||||||    
48879485 aagttttatagaaagatgtaaaaataattctcattggttaaaaattatggagaaaataaaaaggagaacaaattgaatgcaatttgcatttaatttta 48879388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 395 - 475
Target Start/End: Complemental strand, 22369313 - 22369233
Alignment:
395 atgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattt 475  Q
    |||||||||||||||| ||||| |||| ||||| || ||||||||||| |||| | | |||||| ||  ||||||||||||    
22369313 atgtaaaaataatttttattggttattagttatagacaaaatgaaagagagagcataatgaatgcaaattgcatttaattt 22369233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 476
Target Start/End: Complemental strand, 3778071 - 3777984
Alignment:
389 aggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    ||||| || ||||||||||||||||||   ||||||||| || ||||||||||| | || |||||||||| | | | |||||||||||    
3778071 aggaaaatataaaaataattttcattgatcattggttattgagaaaatgaaagagaaagcaaattgaatgcacttttcatttaatttt 3777984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 416
Target Start/End: Complemental strand, 10248637 - 10248594
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattgg 416  Q
    |||||| ||||||||||| |||||||||||| ||||||||||||    
10248637 ttgaaataagttttatagaaagatgtaaaaacaattttcattgg 10248594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 416
Target Start/End: Complemental strand, 40560486 - 40560443
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattgg 416  Q
    |||||| ||||||||||| ||||||||||||||||| |||||||    
40560486 ttgaaataagttttatagaaagatgtaaaaataattctcattgg 40560443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 448 - 486
Target Start/End: Original strand, 35068961 - 35068999
Alignment:
448 aaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||||| |||||||||| ||||||||||||    
35068961 aaaattgaatgtaatttgcatttaatattatgagaataa 35068999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 438 - 485
Target Start/End: Complemental strand, 4069020 - 4068972
Alignment:
438 aaagaaagagaaaa-ttgaatgtaatatgcatttaattttatgagaata 485  Q
    |||||||||||||| ||||||||||| || ||||||||| |||||||||    
4069020 aaagaaagagaaaaattgaatgtaatttgtatttaatttcatgagaata 4068972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 373 - 477
Target Start/End: Original strand, 35084111 - 35084215
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| |||||| |||  |||||||||||| |||| | ||||| || || ||||||| |||||||||   |||  ||||| |||| ||| |||||||||    
35084111 ttgaaataagtttcataaaaagatgtaaaaacaattcttattggataatgattatggagaaaatgaaaaggagaacaaattcaatgcaatttgcatttaa 35084210  T
473 tttta 477  Q
    |||||    
35084211 tttta 35084215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 72)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 364 - 487
Target Start/End: Original strand, 23311595 - 23311718
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23311595 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 23311694  T
464 tgcatttaattttatgagaataac 487  Q
    | ||||||||||||||||||||||    
23311695 tacatttaattttatgagaataac 23311718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 364 - 487
Target Start/End: Original strand, 37042419 - 37042542
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| | ||| ||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     
37042419 gtgttttcgttggaaaaagttttataggaagatgtaaaaacaattttcattggctattgattatggaaaaaatgaaagaaagagaaaattgaatgtaatt 37042518  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
37042519 tgcatttaattttatgagaataac 37042542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 364 - 482
Target Start/End: Original strand, 579140 - 579258
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||     
579140 gtgttttctttgaaaaaagttttataggaagatataaaaacaattttcattggctattggttatggaaaaaatgaaagagagagaaaattgaatgtaatt 579239  T
464 tgcatttaattttatgaga 482  Q
    |||||||||||||||||||    
579240 tgcatttaattttatgaga 579258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 364 - 487
Target Start/End: Complemental strand, 30189693 - 30189569
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaa-aaaatgaaagaaagagaaaattgaatgtaat 462  Q
    |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||    
30189693 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaaatgaaagaaagagaatattgaatgtaat 30189594  T
463 atgcatttaattttatgagaataac 487  Q
     | |||||||||||| |||||||||    
30189593 ttacatttaattttacgagaataac 30189569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 6438205 - 6438083
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||| |||||| ||||||||     
6438205 gtgttttctttgaaaaaagctttataggaagatgtaaaaacaattttcattggctattggttatggagaaaatgaaagagagataaaattaaatgtaatt 6438106  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
6438105 tgcatttaattttatgagaataa 6438083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 14752210 - 14752332
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| |||||  |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||     
14752210 gtgttttctttggaaaaaaatttataggaagatgtaaaaacaattttcattgactattggttatggaaaaaatgaaagagagagaaaattgaatgtaatt 14752309  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
14752310 tgcatttaattttatgagaataa 14752332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 28875528 - 28875406
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||     
28875528 gtgttttctttggaaaaagttttataagaagatgtaaaaacaattttcattggctattggttatggagaaaatgaaagaaaaagaaaattgaatgtaatt 28875429  T
464 tgcatttaattttatgagaataa 486  Q
    || ||||||||||||||||||||    
28875428 tgtatttaattttatgagaataa 28875406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 50651039 - 50651161
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||| |||||||||||||||||||     
50651039 gtgttttctttgcaaaaagttttataggaagatgtaaaaacaattttcattgactattggttatggagaaaataaaagagagagaaaattgaatgtaatt 50651138  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
50651139 tgcatttaattttatgagaataa 50651161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 47864306 - 47864191
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| ||||||||||||| ||| ||||||||||||||| |||||||    
47864306 ctttgaaaaaagttttataggaagatgtaaaaacaattttcattgactattgattatgaaaaaaatgaaagagagaaaaaattgaatgtaatttgcattt 47864207  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
47864206 aattttatgagaataa 47864191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 371 - 486
Target Start/End: Original strand, 7866492 - 7866607
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||| ||||| | ||||||||||||||||| | |||||    
7866492 ctttgaaaaaagttttataagaagatgtaaaaacaattttcattgactattggttatggaaaaaataaaagagatagaaaattgaatgtaattttcattt 7866591  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
7866592 aattttatgagaataa 7866607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 375 - 487
Target Start/End: Original strand, 11054325 - 11054433
Alignment:
375 gaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatt 474  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||    |||||||||||||||||||||| |||||||||||    
11054325 gaaaaaagttttataggaagatttaaaaacaattttcattggctattggttatggaaaaaat----gaaagagaaaattgaatgtaatttgcatttaatt 11054420  T
475 ttatgagaataac 487  Q
    |||||||||||||    
11054421 ttatgagaataac 11054433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 6075203 - 6075081
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||| ||| ||||||| ||||||| ||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||     
6075203 gtgttttctttggaaaaagtgttacaggaagaagtaaaaacaattttcattggccattggttatgcaaaaaatgaaagagagagaaaattgaatgtaatt 6075104  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
6075103 tgcatttaattttatgagaataa 6075081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 46711660 - 46711781
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| ||||||| |||||||||||     
46711660 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaatattcattggctattggttat-gaaaaaatgaaagagagagaaatttgaatgtaatt 46711758  T
464 tgcatttaattttatgagaataa 486  Q
    || |||||||||||||| |||||    
46711759 tgtatttaattttatgaaaataa 46711781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 53270357 - 53270233
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaag--agaaaattgaatgtaa 461  Q
    |||||| ||||||||||||||| |||| |||||| ||||||||||||||||| |||||||||||||||||||||||||| ||  ||||||||||||||||    
53270357 gtgttttctttgaaaaaagtttcatagaaagatgaaaaaataattttcattgcctattggttatggaaaaaatgaaagagagaaagaaaattgaatgtaa 53270258  T
462 tatgcatttaattttatgagaataa 486  Q
    | || ||||||||||||||||||||    
53270257 tttgtatttaattttatgagaataa 53270233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 36546657 - 36546542
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| ||||||||| ||||||||||||||||  ||||||||||||||||||||||| |||||||||||||| ||||| |||| |||||||| |||||||    
36546657 ctttggaaaaagtttcataggaagatgtaaaaccaattttcattggctattggttatagaaaaaatgaaagagagagagaatttaatgtaatttgcattt 36546558  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
36546557 aattttatgagaataa 36546542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 371 - 486
Target Start/End: Original strand, 36561658 - 36561773
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| ||||||||| ||||||||||||||||  ||||||||||||||||||||||| |||||||||||||| ||||| |||| |||||||| |||||||    
36561658 ctttggaaaaagtttcataggaagatgtaaaaccaattttcattggctattggttatagaaaaaatgaaagagagagagaatttaatgtaatttgcattt 36561757  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
36561758 aattttatgagaataa 36561773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 37075082 - 37074958
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatg--aaagaaagagaaaattgaatgtaa 461  Q
    |||||| ||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||  |||||  || ||||||||||||||    
37075082 gtgttttctttggaaaaagttttataggaagatgtaaacacaattttcattggctattggttatagaaaaaatgaaaaagagcgataaaattgaatgtaa 37074983  T
462 tatgcatttaattttatgagaataa 486  Q
    | |||||||||||||||||||||||    
37074982 tttgcatttaattttatgagaataa 37074958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 385 - 486
Target Start/End: Original strand, 54464918 - 54465019
Alignment:
385 ttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaat 484  Q
    ||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||| ||| |||||||||||||||||    
54464918 ttataggaagatgtaaaaacaattttcgttggctattggttatggaaaaagtgaaagagagagaaaattgaatgtaatttgcgtttaattttatgagaat 54465017  T
485 aa 486  Q
    ||    
54465018 aa 54465019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 372 - 486
Target Start/End: Complemental strand, 35963266 - 35963152
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||| ||||||||||||||||||||| ||||| |||||| ||||| ||||||||||||| ||||||||||| |||||||||| |||| ||| ||||||||    
35963266 tttggaaaaagttttataggaagatggaaaaacaatttttattggttattggttatggagaaaatgaaagagagagaaaattaaatgcaatttgcattta 35963167  T
472 attttatgagaataa 486  Q
    |||||||||||||||    
35963166 attttatgagaataa 35963152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 2927404 - 2927289
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||  |||| |||||||||| |||||||| || ||||    
2927404 ctttggaataagttttatgggaagatgtaaaaataattttcattggctattggttatgaaaaaaatagaagagagagaaaattaaatgtaatttgtattt 2927305  T
471 aattttatgagaataa 486  Q
    ||||| ||||||||||    
2927304 aatttcatgagaataa 2927289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 32619832 - 32619954
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || | |||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||  | | |||||||||||||||||||     
32619832 gtgttttctttggaataggttttataagaagatgtaaaaataattttcattggctattggttatggagaaattgggatagagagaaaattgaatgtaatt 32619931  T
464 tgcatttaattttatgagaataa 486  Q
    ||||||||||||||| |||||||    
32619932 tgcatttaattttattagaataa 32619954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 380 - 481
Target Start/End: Original strand, 34722623 - 34722724
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    |||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||   ||||||||||||||||||| | ||||||||||||||    
34722623 aagttttataagaagatgtaaaaacaattttcattggctattggttatgcaaaaaatgaaaaggagagaaaattgaatgtaatttacatttaattttatg 34722722  T
480 ag 481  Q
    ||    
34722723 ag 34722724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 19464197 - 19464075
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||  ||||| ||||||||||   |||||||||||| |||||||||||| ||| ||| |||||||||||     
19464197 gtgttttctttgaaaaaagttttataggaagattgaaaaacaattttcatttattattggttatgggaaaaatgaaagagagaaaaagttgaatgtaatt 19464098  T
464 tgcatttaattttatgagaataa 486  Q
    ||||||| | |||||||||||||    
19464097 tgcatttcagtttatgagaataa 19464075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 41476338 - 41476453
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||||||||||| ||||||||||||||||||||||||||       || ||||||||||||||  | |||||||||||| ||||     
41476338 gtgttttctttgaaaaaagttttatagaaagatgtaaaaataattttcattggc-------tagggaaaaaatgaaagggaaagaaaattgaatctaatt 41476430  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
41476431 tgcatttaattttatgagaataa 41476453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 398 - 486
Target Start/End: Original strand, 46557237 - 46557325
Alignment:
398 taaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||||| | |||||||||| ||||||||||    
46557237 taaaaataattttcattggctattagttatggaaaaaatgaaagagagagaaaattaaatgtaatttacatttaatttcatgagaataa 46557325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 373 - 476
Target Start/End: Original strand, 8097029 - 8097132
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| ||||||||||||||||||||||||||||||||||||| ||||| |||| || ||||||||||| |||| |||||||||| | | |||||||||    
8097029 ttgaaataagttttataggaagatgtaaaaataattttcattggttattgcttattgagaaaatgaaagagagagcaaattgaatgcactttgcatttaa 8097128  T
473 tttt 476  Q
    ||||    
8097129 tttt 8097132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 50730223 - 50730109
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| ||||||||||||||||||||||||||| ||  | ||||| |||||||||||||||||||| ||| | ||||||||||||||||||| | |||||    
50730223 ctttggaaaaagttttataggaagatgtaaaaaaaaaat-cattgactattggttatggaaaaaataaaaaagagagaaaattgaatgtaatttacattt 50730125  T
471 aattttatgagaataa 486  Q
    ||||||| ||||||||    
50730124 aattttaagagaataa 50730109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 371 - 486
Target Start/End: Original strand, 50782631 - 50782745
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| ||||||||||||||||||||||||||| ||  | ||||| |||||||||||||||||||| ||| | ||||||||||||||||||| | |||||    
50782631 ctttggaaaaagttttataggaagatgtaaaaaaaaaat-cattgactattggttatggaaaaaataaaaaagagagaaaattgaatgtaatttacattt 50782729  T
471 aattttatgagaataa 486  Q
    ||||||| ||||||||    
50782730 aattttaagagaataa 50782745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 384 - 486
Target Start/End: Complemental strand, 8703209 - 8703109
Alignment:
384 tttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaa 483  Q
    |||||||||||||||||||| ||||| |||||||||||| ||||||||||| ||||||| | |||||||| |||||||| ||||||||||||||||||||    
8703209 tttataggaagatgtaaaaacaattt-cattggctattgattatggaaaaa-tgaaagagaaagaaaatttaatgtaatttgcatttaattttatgagaa 8703112  T
484 taa 486  Q
    |||    
8703111 taa 8703109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 384 - 486
Target Start/End: Complemental strand, 9055096 - 9054996
Alignment:
384 tttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaa 483  Q
    |||||||||||||||||||| ||||| |||||||||||| ||||||||||| ||||||| | |||||||| |||||||| ||||||||||||||||||||    
9055096 tttataggaagatgtaaaaacaattt-cattggctattgattatggaaaaa-tgaaagagaaagaaaatttaatgtaatttgcatttaattttatgagaa 9054999  T
484 taa 486  Q
    |||    
9054998 taa 9054996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 364 - 485
Target Start/End: Original strand, 20847270 - 20847391
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || |||||| ||||||||||||  ||| ||||||||||||  |||| ||||||| ||||||||||| ||  |||||||||||||||     
20847270 gtgttttctttggaataagtttcataggaagatgtgcaaacaattttcattggtaattgattatggagaaaatgaaagagaggaaaaattgaatgtaatt 20847369  T
464 tgcatttaattttatgagaata 485  Q
    ||||||||||||||||||||||    
20847370 tgcatttaattttatgagaata 20847391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 364 - 433
Target Start/End: Original strand, 23910515 - 23910584
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaa 433  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23910515 gtgttttctttgtaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaa 23910584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 380 - 486
Target Start/End: Complemental strand, 3972381 - 3972275
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    ||||||||| |||||||||||||| |||||||||| ||||||||||| | | |||||| |||| |||  |||||||||||||| |||||||||||| |||    
3972381 aagttttatgggaagatgtaaaaacaattttcattagctattggttaggaagaaaatggaagagagaacaaattgaatgtaatttgcatttaatttcatg 3972282  T
480 agaataa 486  Q
    |||||||    
3972281 agaataa 3972275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 380 - 486
Target Start/End: Original strand, 3997497 - 3997603
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    ||||||||| |||||||||||||| |||||||||| ||||||||||| | | |||||| |||| |||  |||||||||||||| |||||||||||| |||    
3997497 aagttttatgggaagatgtaaaaacaattttcattagctattggttaggaagaaaatggaagagagaacaaattgaatgtaatttgcatttaatttcatg 3997596  T
480 agaataa 486  Q
    |||||||    
3997597 agaataa 3997603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 377 - 486
Target Start/End: Complemental strand, 29235296 - 29235193
Alignment:
377 aaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||      ||| ||||||||||||| | ||||||||||     
29235296 aaaacgtttaataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaa------agagaattgaatgtaatttacatttaattta 29235203  T
477 atgagaataa 486  Q
    |||| |||||    
29235202 atgataataa 29235193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 374 - 476
Target Start/End: Complemental strand, 34194994 - 34194892
Alignment:
374 tgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaat 473  Q
    ||||| |||||||||||||||||||||||| |||||||||||| |||||||||| || ||||||||||| |||| ||| |||||| | | ||||||||||    
34194994 tgaaataagttttataggaagatgtaaaaacaattttcattggttattggttattgagaaaatgaaagagagagcaaactgaatgcactttgcatttaat 34194895  T
474 ttt 476  Q
    |||    
34194894 ttt 34194892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 392 - 486
Target Start/End: Complemental strand, 6752764 - 6752670
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||| |||||| ||||||||||||||||||| |||||| |||| |||| ||| |||||||||| |||||||||||| |||| |||||    
6752764 aagatgtaaaaacaattttaattggctattggttatggagaaaatggaagagagaggaaaatgaatgtaatttgcatttaatttcatgaaaataa 6752670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 392 - 486
Target Start/End: Complemental strand, 26208108 - 26208014
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||| |||||||||||||||||  || |||| |||||| ||||||||||||||||||||||||  |||||| | |||||||||||||    
26208108 aagatgtaaaaacaattttcattggctatttattgtggagaaaatggaagaaagagaaaattgaatgtaattggcatttgaatttatgagaataa 26208014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 373 - 458
Target Start/End: Original strand, 16032998 - 16033083
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatg 458  Q
    |||||| |||||||||||||||||||||||| |||||||||||| |||| ||||| |||||||||||||| | || ||||||||||    
16032998 ttgaaataagttttataggaagatgtaaaaacaattttcattggttattagttattgaaaaaatgaaagagaaagcaaattgaatg 16033083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 417 - 486
Target Start/End: Original strand, 33974614 - 33974683
Alignment:
417 ctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||||| | |||||||| |||||||| |||||||||||||||||||||||    
33974614 ctattggttatggaaaaaatgaaagagaaagaaaatttaatgtaatttgcatttaattttatgagaataa 33974683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 390 - 486
Target Start/End: Original strand, 47866941 - 47867036
Alignment:
390 ggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||| |||||||||  ||||||||||||||||| ||||||| ||| || |||| ||||||||||||||||||| ||||||||| |||||||||||||    
47866941 ggaatatgtaaaaaccattttcattggctattgattatggagaaagtggaagagagagaaaattgaatgtaatttgcatttaa-tttatgagaataa 47867036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 373 - 476
Target Start/End: Original strand, 30454736 - 30454838
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| ||||||||||| |||||||||||| |||||| ||||| |||||||||| || ||||||||||| |||| |||||||||| | | |||||||||    
30454736 ttgaaataagttttatagaaagatgtaaaaacaatttt-attggttattggttattgagaaaatgaaagagagagcaaattgaatgcactttgcatttaa 30454834  T
473 tttt 476  Q
    ||||    
30454835 tttt 30454838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 26724993 - 26725115
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || ||||||| |  ||||||||||||| |||||||||||| ||||| ||||||| |||||  |||| ||| |||| ||||||||||     
26724993 gtgttttctttggaataagttttctgagaagatgtaaaaacaattttcattggttattgattatggagaaaatagaagagagataaaactgaatgtaatt 26725092  T
464 tgcatttaattttatgagaataa 486  Q
    ||||| |||||| ||||||||||    
26725093 tgcatataatttcatgagaataa 26725115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 371 - 476
Target Start/End: Complemental strand, 38401489 - 38401384
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||| ||||||||||||||||||||||||   ||  |||| || ||||||||| | |||||||||| |||||| | |||||||    
38401489 ctttgaaataagttttatagggagatgtaaaaataattttcattggtagttaattatagagaaaatgaaaaagagagaaaattaaatgtactttgcattt 38401390  T
471 aatttt 476  Q
    ||||||    
38401389 aatttt 38401384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 373 - 476
Target Start/End: Original strand, 7886628 - 7886731
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| || |||||||| |||||||||||| |||||||||||| |||| ||||| || ||||||||||| |||| |||||||||| | | ||||||| |    
7886628 ttgaaataaattttatagaaagatgtaaaaacaattttcattggttattagttattgagaaaatgaaagagagagcaaattgaatgcactttgcatttga 7886727  T
473 tttt 476  Q
    ||||    
7886728 tttt 7886731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 427
Target Start/End: Complemental strand, 9264673 - 9264610
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttat 427  Q
    |||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||    
9264673 gtgttttctttgaaaaaagttttatatgaagatgtaaaaacaattttcattggctattcgttat 9264610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 371 - 476
Target Start/End: Complemental strand, 10115020 - 10114915
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| ||||||||||||   ||| |||| || ||||||||| | |||| |||||||||| | | ||| |||    
10115020 ctttgaaataagttttataggaagatgtaaaaacaattttcattggtagttgattatagagaaaatgaaaaatagagcaaattgaatgcactttgctttt 10114921  T
471 aatttt 476  Q
    ||||||    
10114920 aatttt 10114915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 371 - 476
Target Start/End: Complemental strand, 10252120 - 10252015
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| ||||||||||||   ||| |||| || ||||||||| | |||| |||||||||| | | ||| |||    
10252120 ctttgaaataagttttataggaagatgtaaaaacaattttcattggtagttgattatagagaaaatgaaaaatagagcaaattgaatgcactttgctttt 10252021  T
471 aatttt 476  Q
    ||||||    
10252020 aatttt 10252015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 22479063 - 22479168
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| | ||||||||||   ||| |||| || ||||||||| | |||| |||||||||| | | |||||||    
22479063 ctttgaaataagttttataggaagatgtaaaaacacttttcattggtagttgattatagagaaaatgaaaaagagagcaaattgaatgcactttgcattt 22479162  T
471 aatttt 476  Q
    ||||||    
22479163 aatttt 22479168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 397 - 486
Target Start/End: Complemental strand, 38674959 - 38674870
Alignment:
397 gtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||| ||||||||||| |||||| ||||| | ||||||||||| |||||||||||||| |||| || ||||||||| || |||||||    
38674959 gtaaaaacaattttcattgactattgattatgaagaaaatgaaagagagagaaaattgaatctaatttgtatttaatttcataagaataa 38674870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 380 - 476
Target Start/End: Original strand, 46918231 - 46918327
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    ||||||||||||||||| |||||| |||||||||||| |||||||||| || ||||||||||| || | |||| ||||| | | |||| ||||||||    
46918231 aagttttataggaagatctaaaaacaattttcattggttattggttattgagaaaatgaaagagagtgcaaatggaatgcactttgcacttaatttt 46918327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 430 - 486
Target Start/End: Original strand, 48802548 - 48802604
Alignment:
430 aaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||    
48802548 aaaaaatgaaagagagagaaaattgaatgtaatttgcatttacttttatgagaataa 48802604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 371 - 476
Target Start/End: Complemental strand, 10014378 - 10014273
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| ||||||||||||   ||| |||| || ||||| ||| | |||| |||||||||| | | ||| |||    
10014378 ctttgaaataagttttataggaagatgtaaaaacaattttcattggtagttgattatagagaaaataaaaaatagagtaaattgaatgcactttgctttt 10014279  T
471 aatttt 476  Q
    ||||||    
10014278 aatttt 10014273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 22456017 - 22456122
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| ||||||||||||||||| |||||| |||||| |||||   ||| |||| || ||||||||| | |||| |||||||||| | | |||||||    
22456017 ctttgaaataagttttataggaagatataaaaacaattttgattggtagttgattatagagaaaatgaaaaagagagcaaattgaatgcattttgcattt 22456116  T
471 aatttt 476  Q
    ||||||    
22456117 aatttt 22456122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 371 - 476
Target Start/End: Complemental strand, 48291931 - 48291826
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||| ||| ||||||||||||||| |||||||||||||||||||||   ||| |||  |||||||||||| | |||| |||||||||| | | | |||||    
48291931 ctttaaaataagttttataggaaggtgtaaaaataattttcattggtagttgattacagaaaaaatgaaaaagagagcaaattgaatgcactttccattt 48291832  T
471 aatttt 476  Q
    ||||||    
48291831 aatttt 48291826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 372 - 476
Target Start/End: Complemental strand, 21214349 - 21214245
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    ||||||| ||||||||||| |||||||||||| ||||||||||||   ||| |||| || ||||| ||| | |||| |||||||||| | | ||||||||    
21214349 tttgaaataagttttatagaaagatgtaaaaacaattttcattggtagttgattattgagaaaataaaaaagagagcaaattgaatgcactttgcattta 21214250  T
472 atttt 476  Q
    |||||    
21214249 atttt 21214245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 371 - 439
Target Start/End: Complemental strand, 31837034 - 31836966
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaa 439  Q
    ||||| ||||||||||||||||| ||| ||||| ||||||||||| ||||||||| |||| ||||||||    
31837034 ctttggaaaaagttttataggaatatgcaaaaacaattttcattgactattggttgtggagaaaatgaa 31836966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 383 - 486
Target Start/End: Complemental strand, 47115952 - 47115849
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgaga 482  Q
    |||||| | |||||||||||  ||||||| |||| ||||| ||||||| |||||| || |||||||||||| |||| ||| |  ||||||||| ||||||    
47115952 ttttatggaaagatgtaaaagcaattttctttggttattgattatggataaaatggaaaaaagagaaaattaaatgaaatttatatttaatttcatgaga 47115853  T
483 ataa 486  Q
    ||||    
47115852 ataa 47115849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 392 - 477
Target Start/End: Complemental strand, 51426706 - 51426621
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    ||||||||||||||||||||||||| ||    ||||||| ||||| |||  ||||  |||||||||||||| ||||||||||||||    
51426706 aagatgtaaaaataattttcattggttaaaaattatggagaaaataaaaagaagaacaaattgaatgtaatttgcatttaatttta 51426621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 477
Target Start/End: Complemental strand, 31126318 - 31126214
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| ||||||||| | ||||||||||||||||||||||||| ||    ||||||| ||||| |||   |||  |||||||||| ||| |||||||||    
31126318 ttgaaataagttttatggaaagatgtaaaaataattttcattggttaaaaattatggagaaaataaaaaggagaacaaattgaatgcaatttgcatttaa 31126219  T
473 tttta 477  Q
    |||||    
31126218 tttta 31126214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 423 - 486
Target Start/End: Complemental strand, 9264071 - 9264008
Alignment:
423 gttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||| ||| ||||||||||| ||| ||||||  ||||||| |||||||||||||||||||||||    
9264071 gttacggagaaaatgaaagagagataaaattagatgtaatttgcatttaattttatgagaataa 9264008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 373 - 475
Target Start/End: Original strand, 23209291 - 23209393
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| ||||||||||| |||||| |||||||||||| ||||| |||| ||||  || ||||||||||  |||  | | |||||| ||| |||||||||    
23209291 ttgaaataagttttatagaaagatgaaaaaataatttttattggttattagttagagagaaaatgaaagggagaacataatgaatgcaatttgcatttaa 23209390  T
473 ttt 475  Q
    |||    
23209391 ttt 23209393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 364 - 422
Target Start/End: Original strand, 33973569 - 33973627
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattg 422  Q
    |||||| |||| ||||||||||||||| |||| || ||||||||||||| |||||||||    
33973569 gtgttttctttaaaaaaagttttatagaaagacgtcaaaataattttcagtggctattg 33973627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 380 - 422
Target Start/End: Original strand, 54725628 - 54725670
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattg 422  Q
    |||||||||||||||||||||||| |||||||||||| |||||    
54725628 aagttttataggaagatgtaaaaacaattttcattggttattg 54725670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 381 - 438
Target Start/End: Original strand, 3084199 - 3084256
Alignment:
381 agttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatga 438  Q
    |||||||| |||||||||||||| ||| |||||||| |||| |||||||| |||||||    
3084199 agttttatgggaagatgtaaaaacaatattcattggttatttgttatggagaaaatga 3084256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 414
Target Start/End: Complemental strand, 6784421 - 6784390
Alignment:
383 ttttataggaagatgtaaaaataattttcatt 414  Q
    ||||||||||||||||||||||||||||||||    
6784421 ttttataggaagatgtaaaaataattttcatt 6784390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 447 - 486
Target Start/End: Original strand, 23910580 - 23910619
Alignment:
447 gaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||||| ||||||||||| |||||||||||    
23910580 gaaaattgaatgtaatttgcatttaattatatgagaataa 23910619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 481
Target Start/End: Complemental strand, 34722599 - 34722564
Alignment:
446 agaaaattgaatgtaatatgcatttaattttatgag 481  Q
    ||||||||||||||||| ||||||||||||||||||    
34722599 agaaaattgaatgtaatttgcatttaattttatgag 34722564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 380 - 458
Target Start/End: Complemental strand, 36151025 - 36150946
Alignment:
380 aagttttataggaagatgtaaaa-ataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatg 458  Q
    ||||||||| ||||||||||||| |||||||| ||||| ||||| ||||||| |||||| ||  ||||| ||||| ||||    
36151025 aagttttatgggaagatgtaaaacataatttttattggttattgattatggagaaaatggaaataagagtaaattaaatg 36150946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 392 - 477
Target Start/End: Complemental strand, 1335197 - 1335112
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    ||||||||||||||||||| ||||| ||    ||||||| ||||| |||  ||||  |||||||||| ||| ||||||||||||||    
1335197 aagatgtaaaaataatttttattggttaaaaattatggagaaaataaaaagaagaacaaattgaatgcaatttgcatttaatttta 1335112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 47443983 - 47444087
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| || |||||||| |||||||||||| |||||||| |||   ||| |||| || ||||||||| | | || |||||||||| | | |||||||    
47443983 ctttgaaataaattttatag-aagatgtaaaaacaattttcactggtagttgattatagagaaaatgaaaaagatagcaaattgaatgcactttgcattt 47444081  T
471 aatttt 476  Q
    ||||||    
47444082 aatttt 47444087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 419 - 486
Target Start/End: Original strand, 41936248 - 41936313
Alignment:
419 attggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||  |||  |||||||||||||| ||| |||||||| ||| ||||||||||    
41936248 attggttatggagaaaatgggaga--gagaaaattgaatgcaatttgcatttagtttcatgagaataa 41936313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 111; Significance: 9e-56; HSPs: 48)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 11261927 - 11262049
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
11261927 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 11262026  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
11262027 tgcatttaattttatgagaataa 11262049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 375 - 487
Target Start/End: Complemental strand, 6686491 - 6686379
Alignment:
375 gaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatt 474  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
6686491 gaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatttgcatttaatt 6686392  T
475 ttatgagaataac 487  Q
    |||||||||||||    
6686391 ttatgagaataac 6686379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 364 - 487
Target Start/End: Original strand, 43590005 - 43590128
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||  ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
43590005 gtgttttcttttgaaaaagttttatagggagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 43590104  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
43590105 tgcatttaattttatgagaataac 43590128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 20644132 - 20644010
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||     
20644132 gtgttttctttggaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagagagggaaaattgaatgtaatt 20644033  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||    
20644032 tgcatttaatttcatgagaataa 20644010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 38130159 - 38130281
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||  ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||     
38130159 gtgttttctttagaaaaagttttataggaatatgtaaaaataattttcattggctattggttatggaaaaaatgaaagagagagaaaattgaatgtaatc 38130258  T
464 tgcatttaattttatgagaataa 486  Q
    | |||||||||||||||||||||    
38130259 tacatttaattttatgagaataa 38130281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 32111120 - 32110998
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| |||||||||| ||||||||     
32111120 gtgttttctttgaaaaaagtttcataggaagatgtaaaaacaattttcattgactattggttatggaaaatatgaaagagagagaaaattaaatgtaatt 32111021  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
32111020 tgcatttaattttatgagaataa 32110998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 372 - 486
Target Start/End: Original strand, 37562813 - 37562927
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||| ||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||    
37562813 tttggaaaaagttttataggaagatgtaaaaacaattttcattagctattgtttatggaaaaaatgaaagacagagaaaattgaatgtaatttgcattta 37562912  T
472 attttatgagaataa 486  Q
    |||||||||||||||    
37562913 attttatgagaataa 37562927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 38280958 - 38280843
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||||||||||||||||||||| ||||||||| |||||||||||| ||||| ||||||||||||||||||| |||||||||||||| |||| |||||||    
38280958 ctttgaaaaaagttttataggaaaatgtaaaaacaattttcattggttattgattatggaaaaaatgaaagagagagaaaattgaatataatttgcattt 38280859  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
38280858 aattttatgagaataa 38280843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 372 - 485
Target Start/End: Original strand, 37522640 - 37522754
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattta 471  Q
    |||| ||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||    
37522640 tttggaaaaagttttataggaagatgtaaaaacaattttcattggctattgtttatggaaaaaatgaaagacagagaaaattgaatgtaatttgcattta 37522739  T
472 a-ttttatgagaata 485  Q
    | |||||||||||||    
37522740 atttttatgagaata 37522754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 42273765 - 42273645
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||  ||||||||||||||| |||     
42273765 gtgttttctttggaaaaagttttataagaagatgtaaaaacaattttcattggctattggttatggagaaaatgaaag--agagaaaattgaatgcaatt 42273668  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
42273667 tgcatttaattttatgagaataa 42273645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 34425448 - 34425327
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| ||||| ||||| |||||||||||||| ||||     
34425448 gtgttttctttgaaaaaagttttataggaatatgtaaaaacaattttcattggctattgattatgga-aaaataaaagagagagaaaattgaatataatt 34425350  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
34425349 tgcatttaattttatgagaataa 34425327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 364 - 484
Target Start/End: Complemental strand, 20039220 - 20039100
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||| |||||||||||||||||||||  |||||| ||||||||||||||||| ||||||||||||| | |||||||| ||||||||     
20039220 gtgttttctttgaaaaaggttttataggaagatgtaaaaccaatttttattggctattggttatgaaaaaaatgaaagagatagaaaattaaatgtaatt 20039121  T
464 tgcatttaattttatgagaat 484  Q
    |||||||||||||||||||||    
20039120 tgcatttaattttatgagaat 20039100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 364 - 485
Target Start/End: Complemental strand, 19413259 - 19413138
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||| ||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||| ||||| || ||||||| ||||||||     
19413259 gtgttttctttgaaataagttttatgggaagatgtaaaaacaattttcattggcaattggttatggaaaaaataaaagagagggaaaattaaatgtaatt 19413160  T
464 tgcatttaattttatgagaata 485  Q
    |||||||||||| |||||||||    
19413159 tgcatttaatttcatgagaata 19413138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 8225573 - 8225459
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataat-tttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatt 469  Q
    ||||| ||||||||||||||||| ||||||||| ||  ||||||||||||||||||||||||||||||||||  ||||||||||||| ||||| ||||||    
8225573 ctttggaaaaagttttataggaaaatgtaaaaaaaaaatttcattggctattggttatggaaaaaatgaaag--agagaaaattgaacgtaatttgcatt 8225476  T
470 taattttatgagaataa 486  Q
    |||||||||||||||||    
8225475 taattttatgagaataa 8225459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 377 - 486
Target Start/End: Complemental strand, 32017808 - 32017700
Alignment:
377 aaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    |||| |||||||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||| ||||||| ||||||||||| |||||||||||||    
32017808 aaaacgttttataggaagatgtaaaaacaattttcattgtctattggttatgga-aaaacgaaagagagagaaagttgaatgtaatttgcatttaatttt 32017710  T
477 atgagaataa 486  Q
    ||||||||||    
32017709 atgagaataa 32017700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 372 - 485
Target Start/End: Original strand, 104265 - 104386
Alignment:
372 tttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaa--------agaaagagaaaattgaatgtaata 463  Q
    ||||||||||||||||||| |||||||||||| |||||||||| |||||| |||||| ||||||||||        ||| ||||||||||||||||||||    
104265 tttgaaaaaagttttatagaaagatgtaaaaacaattttcattagctattagttatgaaaaaaatgaaagagagagagagagagaaaattgaatgtaata 104364  T
464 tgcatttaattttatgagaata 485  Q
    ||||||||||||||||||||||    
104365 tgcatttaattttatgagaata 104386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 4463478 - 4463356
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || ||| || || |||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||     
4463478 gtgttttctttggaataagcttcatgggaagatgtaaaaacaattttcactggctattggttatggaaaaaatgaaagagagagaaaattaaatgtaatt 4463379  T
464 tgcatttaattttatgagaataa 486  Q
    |||| ||||||| ||||| ||||    
4463378 tgcaattaatttcatgagtataa 4463356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 25840982 - 25840860
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || |||||| || |||||||||||||| ||||||||||| | |||| ||||||||||||| ||||| |||||||||| ||||||||     
25840982 gtgttttctttggaataagtttcatgggaagatgtaaaaacaattttcattgacaattgtttatggaaaaaataaaagagagagaaaattaaatgtaatt 25840883  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||    
25840882 tgcatttaatttcatgagaataa 25840860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 390 - 486
Target Start/End: Original strand, 9957488 - 9957581
Alignment:
390 ggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||| ||||||||||||||||||||||| |||||||||||||  ||||||| ||||||||||| |||||||||||||||||||||||    
9957488 ggaagatgtaaaaacaattttcattggctattggttat-gaaaaaatgaaag--agagaaagttgaatgtaatttgcatttaattttatgagaataa 9957581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 39505276 - 39505397
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| || ||||||||| | |||||||||||| ||||||||||||| ||| ||||||| |||||| ||||| |||||||||| ||||||||     
39505276 gtgttttctttggaataagttttatggtaagatgtaaaaacaattttcattggcaattcgttatgg-aaaaataaaagagagagaaaattaaatgtaatt 39505374  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||| ||||||||||    
39505375 tgcatttaatttcatgagaataa 39505397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 12912344 - 12912449
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| |||||||||||||||||||||||| |||||||||||| |||||||| | |||||||||||||| |||| ||||| |||| | | |||||||    
12912344 ctttgaaataagttttataggaagatgtaaaaacaattttcattggttattggttgttgaaaaaatgaaagagagagcaaattaaatgcactttgcattt 12912443  T
471 aatttt 476  Q
    ||||||    
12912444 aatttt 12912449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 380 - 486
Target Start/End: Complemental strand, 17351490 - 17351384
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    ||||||||| | |||||||||||| |||||| ||||||||||| ||||||| ||||||| | | ||||||||||||||||||| | |||||||||| |||    
17351490 aagttttatggaaagatgtaaaaacaattttaattggctattgattatggagaaaatgacatagagagaaaattgaatgtaattttcatttaatttcatg 17351391  T
480 agaataa 486  Q
    |||||||    
17351390 agaataa 17351384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 41625554 - 41625675
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||| |||||| |||||||||||||||||| ||||||||| ||||||| |||| ||||||||| |||| || ||||||| ||||||||     
41625554 gtgttttctttgaaataagtttcataggaagatgtaaaaattattttcattcgctattgattat-gaaaaaatggaagagagggaaaattaaatgtaatt 41625652  T
464 tgcatttaattttatgagaataa 486  Q
    || ||||||||| |||| |||||    
41625653 tgaatttaatttcatgaaaataa 41625675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 380 - 482
Target Start/End: Original strand, 43454382 - 43454484
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatg 479  Q
    |||||||||||||| ||||||||| ||||||||||  |||||||||| | | ||||| ||||| ||||||||||||||||||| | ||||||||| ||||    
43454382 aagttttataggaatatgtaaaaacaattttcatttactattggttaagaagaaaataaaagagagagaaaattgaatgtaatttacatttaattctatg 43454481  T
480 aga 482  Q
    |||    
43454482 aga 43454484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 378 - 486
Target Start/End: Complemental strand, 7071342 - 7071234
Alignment:
378 aaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    |||||||| || |||| ||||||||||||||||||||| |||||| ||| ||| |||||| ||||  | |||||||||||||||| || ||||||||| |    
7071342 aaaagtttcatgggaaaatgtaaaaataattttcattgactattgattacggagaaaatggaagagcgtgaaaattgaatgtaatttgtatttaatttca 7071243  T
478 tgagaataa 486  Q
    |||||||||    
7071242 tgagaataa 7071234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 380 - 476
Target Start/End: Original strand, 10153987 - 10154083
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    |||||||||||||||||||||||| |||||||||||| ||||||| || || ||||||||||| | || |||||||||| | | |||||||||||||    
10153987 aagttttataggaagatgtaaaaacaattttcattggttattggtcattgagaaaatgaaagagatagcaaattgaatgcactttgcatttaatttt 10154083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 371 - 481
Target Start/End: Original strand, 42104298 - 42104408
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||| || |||||| || |||||||||||||| |||||||||||||||||  ||||||| |||||| ||||  || ||||||||||||| | |||||||    
42104298 ctttggaacaagtttcatgggaagatgtaaaaacaattttcattggctattaattatggagaaaatggaagagtgataaaattgaatgtattttgcattt 42104397  T
471 aattttatgag 481  Q
    ||||| |||||    
42104398 aatttcatgag 42104408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 5984151 - 5984280
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatgg-------aaaaaatgaaagaaagagaaaattgaa 456  Q
    |||||| ||||| || ||||||||||| || ||||||||| ||||||||||| ||||||||||| |       | ||||||||||| |||||| ||| ||    
5984151 gtgttttctttggaataagttttatagaaatatgtaaaaacaattttcattgactattggttattggttatagagaaaatgaaagagagagaatatttaa 5984250  T
457 tgtaatatgcatttaattttatgagaataa 486  Q
    |||||| | |||||||||||||||||||||    
5984251 tgtaatttacatttaattttatgagaataa 5984280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 380 - 476
Target Start/End: Original strand, 5369090 - 5369186
Alignment:
380 aagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttt 476  Q
    |||||||||||||||||||||||| |||||||||||| | |||||||| || ||||||||||| || |   |||||||| | | |||||||||||||    
5369090 aagttttataggaagatgtaaaaacaattttcattggttgttggttattgagaaaatgaaagagagggcttattgaatgcactttgcatttaatttt 5369186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 3463865 - 3463970
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| ||||||||||||||||| |||||| |||||| |||||   ||| |||| || ||||||||| | |||| |||||||||| | | |||||||    
3463865 ctttgaaataagttttataggaagatataaaaacaatttttattggtagttgattatagagaaaatgaaaaagagagcaaattgaatgcactttgcattt 3463964  T
471 aatttt 476  Q
    ||||||    
3463965 aatttt 3463970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 448
Target Start/End: Original strand, 12792839 - 12792903
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagaga 448  Q
    ||||||||||||| ||||| | |||||||||||||||||||||||||| ||||||||||| |||||    
12792839 ttttataggaaga-gtaaagacaattttcattggctattggttatggagaaaatgaaagagagaga 12792903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 373 - 476
Target Start/End: Complemental strand, 8506540 - 8506443
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| ||||||||||| |||||||||||| |||||||||||      |||||| || ||||||||||| |||| |||||||||| | | |||||||||    
8506540 ttgaaataagttttatagaaagatgtaaaaacaattttcattg------ggttattgagaaaatgaaagatagagcaaattgaatgcactttgcatttaa 8506447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 444 - 486
Target Start/End: Original strand, 12730103 - 12730145
Alignment:
444 agagaaaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    ||||||||||||||||||| |||||||||||||||||||||||    
12730103 agagaaaattgaatgtaatttgcatttaattttatgagaataa 12730145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 448
Target Start/End: Original strand, 12729937 - 12730001
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagaga 448  Q
    ||||||||||||| ||||| | |||||||||||||||||||||||||| ||||||| ||| |||||    
12729937 ttttataggaaga-gtaaagacaattttcattggctattggttatggagaaaatgagagagagaga 12730001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 371 - 416
Target Start/End: Original strand, 29307237 - 29307282
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattgg 416  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||    
29307237 ctttaaaataagttttataggaagatgtaaaaataattttcattgg 29307282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 371 - 415
Target Start/End: Complemental strand, 8959751 - 8959707
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattg 415  Q
    |||||||| |||||||||||||||||||||||| |||||||||||    
8959751 ctttgaaataagttttataggaagatgtaaaaacaattttcattg 8959707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 364 - 448
Target Start/End: Complemental strand, 23233529 - 23233445
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagaga 448  Q
    |||||| ||||||||| |  |||||||||| ||||||||| | |||| |||  |||||||||||||| ||||||||||| |||||    
23233529 gtgttttctttgaaaacaactttataggaatatgtaaaaacagtttttattaactattggttatggagaaaatgaaagagagaga 23233445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 477
Target Start/End: Original strand, 31690680 - 31690776
Alignment:
381 agttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    |||||||||| ||||||||||||||||||||||||| ||    ||||||| ||||| |||   |||  |||||||||| ||| ||||||||||||||    
31690680 agttttatagaaagatgtaaaaataattttcattggttaaaaattatggagaaaataaaaaggagaacaaattgaatgcaatttgcatttaatttta 31690776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 449 - 486
Target Start/End: Original strand, 12792929 - 12792966
Alignment:
449 aaattgaatgtaatatgcatttaattttatgagaataa 486  Q
    |||||||||||||| |||||||||||||||||||||||    
12792929 aaattgaatgtaatttgcatttaattttatgagaataa 12792966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 392 - 477
Target Start/End: Complemental strand, 24439660 - 24439575
Alignment:
392 aagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    |||||||||||| |||| |||||||||| |  ||||||||||||| |||   |||  |||||||||| ||| ||||||||||||||    
24439660 aagatgtaaaaacaattatcattggctaattattatggaaaaaataaaaaggagaacaaattgaatgcaatttgcatttaatttta 24439575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 442
Target Start/End: Complemental strand, 6391980 - 6391909
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaaga 442  Q
    |||||||| |||||| |||| |||||||||||| || ||| ||||| |||| ||||| || |||||||||||    
6391980 ctttgaaataagtttcatagaaagatgtaaaaacaacttttattggttattagttatagagaaaatgaaaga 6391909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 442
Target Start/End: Complemental strand, 30703712 - 30703641
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaaga 442  Q
    |||||||| || ||||||||||||||||| ||| || ||||||||| ||||| ||||  | |||||||||||    
30703712 ctttgaaataaattttataggaagatgtataaaaaagtttcattggttattgattattcagaaaatgaaaga 30703641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 383 - 477
Target Start/End: Complemental strand, 12638986 - 12638892
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaatttta 477  Q
    |||||| | ||||||||||||||||| ||||||| ||    ||||||| ||||| |||  ||||  |||||||||| ||| ||||||||||||||    
12638986 ttttatggaaagatgtaaaaataattctcattggttaaaaattatggagaaaataaaaagaagaacaaattgaatgcaatttgcatttaatttta 12638892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 373 - 415
Target Start/End: Complemental strand, 32432361 - 32432319
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattg 415  Q
    |||||| ||||||||||  ||||||||||||||||||||||||    
32432361 ttgaaataagttttatataaagatgtaaaaataattttcattg 32432319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 371 - 476
Target Start/End: Original strand, 5736290 - 5736395
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    |||||||| || |||||||||||| |||||||| |||||||||| |   ||| |||  || ||||||||||  |||| |||||||| | | | |||||||    
5736290 ctttgaaataaattttataggaagttgtaaaaacaattttcatttgtcgttgattacagagaaaatgaaagggagagcaaattgaacgcattttgcattt 5736389  T
471 aatttt 476  Q
    ||||||    
5736390 aatttt 5736395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 371 - 416
Target Start/End: Original strand, 16153396 - 16153440
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattgg 416  Q
    |||||||| ||||||||||||||||||||||||  |||||||||||    
16153396 ctttgaaataagttttataggaagatgtaaaaa-cattttcattgg 16153440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 5659584 - 5659676
Alignment:
385 ttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaa-agagaaaattgaatgtaatatgcatttaatttt 476  Q
    ||||||||||||||||||| |||||| |||||   ||| |||| |||||||||||| || | || |||||||||| | | | |||||||||||    
5659584 ttataggaagatgtaaaaacaatttttattggtagttgattatagaaaaaatgaaaaaagaaagcaaattgaatgcactttacatttaatttt 5659676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 373 - 477
Target Start/End: Original strand, 8146065 - 8146169
Alignment:
373 ttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaa 472  Q
    |||||| |||||| || | ||||||||||||||||| ||||| | ||    ||||||| ||||| ||| | |||  |||||||||| ||| |||||||||    
8146065 ttgaaataagtttcatggaaagatgtaaaaataattctcattagttaaaaattatggagaaaataaaaaagagaacaaattgaatgcaatttgcatttaa 8146164  T
473 tttta 477  Q
    |||||    
8146165 tttta 8146169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 111; Significance: 9e-56; HSPs: 43)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 28599190 - 28599312
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28599190 gtgttttctttggaaaaagatttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 28599289  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
28599290 tgcatttaattttatgagaataa 28599312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 364 - 487
Target Start/End: Complemental strand, 35517241 - 35517118
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
35517241 gtgttttctttggaaaaagttttatagtgagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatt 35517142  T
464 tgcatttaattttatgagaataac 487  Q
    ||||||||||||||||||||||||    
35517141 tgcatttaattttatgagaataac 35517118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 3201444 - 3201322
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||     
3201444 gtgttttctttggaaaaagttttatagaaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagataaaattgaatgtaatt 3201345  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
3201344 tgcatttaattttatgagaataa 3201322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 28858427 - 28858305
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||     
28858427 gtgttttctttgaaaaaagttttatagaaagatgtaaaaataattttcattggctattggttattgtaaaaatgaaagagagagaaaattgaatgtaatt 28858328  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
28858327 tgcatttaattttatgagaataa 28858305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 383 - 486
Target Start/End: Complemental strand, 41528355 - 41528252
Alignment:
383 ttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcatttaattttatgaga 482  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
41528355 ttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatttgcatttaattttatgaga 41528256  T
483 ataa 486  Q
    ||||    
41528255 ataa 41528252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 371 - 486
Target Start/End: Complemental strand, 45085368 - 45085253
Alignment:
371 ctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaatatgcattt 470  Q
    ||||||||||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||| ||||||||||||||||||| |||||||    
45085368 ctttgaaaaaagttttataggaagatgtaaaaacaattttcattagccattggttatggaaaaaatgaaagagagagaaaattgaatgtaatttgcattt 45085269  T
471 aattttatgagaataa 486  Q
    ||||||||||||||||    
45085268 aattttatgagaataa 45085253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 45660483 - 45660361
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||| |||||| ||||||||     
45660483 gtgttttctttgaaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggagaaaatgaaagagagataaaattaaatgtaatt 45660384  T
464 tgcatttaattttatgagaataa 486  Q
    |||||||||||||||||||||||    
45660383 tgcatttaattttatgagaataa 45660361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 19264218 - 19264095
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaa-t 462  Q
    |||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |    
19264218 gtgttttctttggaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaattaaagagagagaaaattgaatgtaatt 19264119  T
463 atgcatttaattttatgagaataa 486  Q
     |||||||||||||||||||||||    
19264118 ttgcatttaattttatgagaataa 19264095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 364 - 486
Target Start/End: Original strand, 6110241 - 6110365
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaa--agaaagagaaaattgaatgtaa 461  Q
    |||||| ||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  ||| ||||||||||||||||||    
6110241 gtgttttcttcggaaaaagttttataggaagatgtaaaaacaattttcattggctattggttatggaaaaaatgaaagagagagagaaaattgaatgtaa 6110340  T
462 tatgcatttaattttatgagaataa 486  Q
    | |||||||||||||||||||||||    
6110341 tttgcatttaattttatgagaataa 6110365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 364 - 486
Target Start/End: Complemental strand, 14874081 - 14873958
Alignment:
364 gtgtttcctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggaaaaaatgaaagaaagagaaaattgaatgtaata 463  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||| ||||||||     
14874081 gtgttttctttgaaaaaagttttataggaagatgtaaaaataattttcattggctattggttatggagaaaatgaaagagagataaaattaaatgtaatt 14873982  T
464 tgca-tttaattttatgagaataa 486  Q
    |||| ||||||| |||||||||||