View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920-INSERTION9 (Length: 755)

Name: NF0920-INSERTION9
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920-INSERTION9
NF0920-INSERTION9
[»] chr4 (2 HSPs)
chr4 (80-755)||(32902552-32903223)
chr4 (8-89)||(32901770-32901851)


Alignment Details
Target: chr4 (Bit Score: 602; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 602; E-Value: 0
Query Start/End: Original strand, 80 - 755
Target Start/End: Original strand, 32902552 - 32903223
Alignment:
80 tgatgattgattcaattttatatacaaaggaacaatctcactaacgtggagtaggatgttatttatggtcatttttggctaggaaagaagtatctcaact 179  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
32902552 tgatgattgattcaattttatata-aaaggaacaatctcactaacgtggagtaggatgttatttatggtcatttttggctaggaaagaagtatctcaagt 32902650  T
180 tcgacaacaaataaatgtctaatttgtgcgaccttgagattttagagaagttaatccgtaacatgaacaactgtatgtgtgaaagtgaatttagacaaaa 279  Q
    |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32902651 tcgacaacaaataaatgtttaatttgtgcgatcttgagattttagagaagttaatccgtaacatgaacaactgtatgtgtgaaagtgaatttagacaaaa 32902750  T
280 tataagttttgcataaggttaaaattaatttcaatatcatgacaatatcgtcgtgactcaagaaatttttcattcaatttgtagaagtcttaggagagtt 379  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32902751 tataagttttgcataaggttaaaattaatttcaatatcatgacaatatcgtcgtgactcaagaaatttttcattcaatttgtagaagtcttaggagagtt 32902850  T
380 gataatatgattatcttcaagactatagatctcttcctccaaactatcataaaagaacgtcgtcttcgcttcaagttgctcaacatctaggttcaaatta 479  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32902851 gataatatgattatcttcaagactatagatctcttcccccaaactatcataaaagaacgtcgtcttcgcttcaagttgctcaacatctaggttcaaatta 32902950  T
480 gagactaattcaaacacagctcaaatagaaatcatctttacccatgagagattcttttcaaaatcaatatgcatgcttcccctaattaaattctttcaca 579  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32902951 gagactaattcaaacacagctcaaatagaaatcatctttacccatgagagattcttttcaaaatcaatatgcatgcttcccctaattaaattctttcaca 32903050  T
580 atcaatatttgattgggagttattttgatcatatgcaattattatgtataaccatttgttcctctnnnnnnnntgtatacccatttgcgagtgtttttct 679  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||    
32903051 atcaatatttgattgggagttattttgatcatatgcaattattatgtataaccatttgttcctctaaaaaaaatgtatacccatttgcgagtgtttttct 32903150  T
680 cccccaacaagtccaatcaaactcccatatcacttgttagattaaaatccaggggacaacaacgaatcaatgatcc 755  Q
    |||||| |||||||||||||||||| ||||||||||||||   |||||||||||| ||||||||||||||||||||    
32903151 cccccaccaagtccaatcaaactccgatatcacttgttag---aaaatccagggggcaacaacgaatcaatgatcc 32903223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 32901770 - 32901851
Alignment:
8 atgcattcaacaagcatgcaatatatagtaccttctcaaatgtacgctacacgcaaacgtgttttcatgcaatgatgattga 89  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32901770 atgcattcaacaagcatgcaatatatagtaccttctcaaatgtacgctacacgcaaacgtgttttcatgcaatgatgattga 32901851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142443 times since January 2019
Visitors: 1480