View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_1 (Length: 664)

Name: NF0920_high_1
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_high_1
[»] chr6 (1 HSPs)
chr6 (29-648)||(6095086-6095705)
[»] chr8 (1 HSPs)
chr8 (29-651)||(32805209-32805831)

Alignment Details
Target: chr6 (Bit Score: 572; Significance: 0; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 572; E-Value: 0
Query Start/End: Original strand, 29 - 648
Target Start/End: Original strand, 6095086 - 6095705
29 aataacaataggctcaaacacagattggttaaaaaccagttggttcctgtgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 128  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
6095086 aataacaataggctcaaacacagattggttaaaaactagttggttcctatgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 6095185  T
129 tccggcgctgacagccacactttcatccacgatatcaactccaattggtccggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 228  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6095186 tccggcgctgacagccacactttcatccacgatatcaagtccaattggtccggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 6095285  T
229 ggcagcgcataaaaaggtgatccgagtcttctattaaggagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 328  Q
    |||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6095286 ggcagcgcataaaaaggtgatctgagtcttctattgagaagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 6095385  T
329 tggaaggatattttttgccaacccccataagaaattttgtgcacttttagggacaggaatactccaaatacgcttccatatctcataattgttgctattt 428  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||    
6095386 tggaaggatattttttgtcaacctccataagaaattttgtgcacttttagggacgggagtactccaaatacgcttccatatctcagaattgttgctattt 6095485  T
429 gaggattcagcctgctccgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 528  Q
6095486 gaggattcagcctgctccgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 6095585  T
529 ctgttggacgcctaacagataaagggatgcttatgattttcctggctgtgtagttgttgaacctgctaaaaataagaccccggtcccactgatttgtatc 628  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
6095586 ctgttggacgcctaacagataaagggatgcttatgattttcctggctgtgtagttgttgaacctactaaaaataagaccccggtcccactgatttgtatc 6095685  T
629 cctatcaattaattccgcaa 648  Q
6095686 cctatcaattaattccgcaa 6095705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 571; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 571; E-Value: 0
Query Start/End: Original strand, 29 - 651
Target Start/End: Complemental strand, 32805831 - 32805209
29 aataacaataggctcaaacacagattggttaaaaaccagttggttcctgtgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 128  Q
32805831 aataacaataggctcaaacacagattggttaaaaaccagttggttcctgtgactccaaatcagccagagggagtagcagaataattgttgggcacgggtg 32805732  T
129 tccggcgctgacagccacactttcatccacgatatcaactccaattggtccggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 228  Q
    |||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
32805731 tccggcgctgacagccacactttcatccacgatatcaagttcaattggttcggtacatggatcccaagaggggaagagaaccagactgctaaggcagcag 32805632  T
229 ggcagcgcataaaaaggtgatccgagtcttctattaaggagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 328  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32805631 ggcagcgcataaaaaggtgatccgagtcttctattgaggagttacaaagaggacaactcatatccagggatatacctttcttacccaaattacttctagt 32805532  T
329 tggaaggatattttttgccaacccccataagaaattttgtgcacttttagggacaggaatactccaaatacgcttccatatctcataattgttgctattt 428  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| ||||||||||||||    
32805531 tggaaggatattttttgccaacctccataagaaattttgtgcacttttagggacgggaatgctccaaatacgcttccaaatctcagaattgttgctattt 32805432  T
429 gaggattcagcctgctccgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 528  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32805431 gaggattcagcctgctctgagtttctatcctcacacattgcatgatgcgccgatctcacagagtagacaccattcttttcccaatgccatatgattttgt 32805332  T
529 ctgttggacgcctaacagataaagggatgcttatgattttcctggctgtgtagttgttgaacctgctaaaaataagaccccggtcccactgatttgtatc 628  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
32805331 ctgttggacgcctaacagataaagggatgcttatgattttcctggctatgtagttattgaacctgctaaaaataagaccccggtcccactgatttgtatc 32805232  T
629 cctatcaattaattccgcaacag 651  Q
    ||||||||||||||| |||||||    
32805231 cctatcaattaattctgcaacag 32805209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149674 times since January 2019
Visitors: 1517