View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_10 (Length: 301)

Name: NF0920_high_10
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_10
NF0920_high_10
[»] chr2 (1 HSPs)
chr2 (75-251)||(15885913-15886089)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 75 - 251
Target Start/End: Complemental strand, 15886089 - 15885913
Alignment:
75 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15886089 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 15885990  T
175 agaggggtctccttgccttaaccctctaccagaaataaaaggaacaggtgtgctaccattaaacaaaatagaataat 251  Q
    |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||    
15885989 agaggggtctccttgccttaaccctctaccaggaataaaaggtacaggtgtgctaccattaaacaaaatagaataat 15885913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142029 times since January 2019
Visitors: 1479