View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_12 (Length: 282)

Name: NF0920_high_12
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_high_12
[»] chr4 (1 HSPs)
chr4 (1-279)||(4075284-4075562)
[»] chr7 (1 HSPs)
chr7 (5-201)||(25824676-25824872)

Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 4075284 - 4075562
1 gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||    
4075284 gagacaccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttagaggctcccattgcttcctatagatagatggatgaccttct 4075383  T
101 tttctgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttcaaatcttctagaacattttcaaccacttgcatcattttag 200  Q
    |||||||||||||| || ||||| |||||||||||||||||||||||||||||  |||||||||||| |||||||||||| |||||||||||||||||||    
4075384 tttctgtactctgagagttgtgttatgttaagcaattgaacattcaaacctcttcttttcaaatcttgtagaacattttccaccacttgcatcattttag 4075483  T
201 gaacagaaccatttccactatatccatcttctgtaatttgatctctttctttgtaacaattttcaccctatgctactcc 279  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||| ||||    
4075484 gaacagaaccatttccactatatccctcttctttaatttgatctctttctttgtaacaattttcaccctttgctcctcc 4075562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 5 - 201
Target Start/End: Complemental strand, 25824872 - 25824676
5 caccaatgtatgcaatctgcataagattttggatttgatatttgctcttctgttaaaggctcccattgcttcctatagatagatggatggccttcttttc 104  Q
    ||||||||||||||||||||||||   |||||||||||||| || ||||  |||| ||| ||||| || |||||||||||||| || || ||||||||||    
25824872 caccaatgtatgcaatctgcataaccatttggatttgatatctgttcttgagttagaggttcccactgtttcctatagatagaagggtgaccttcttttc 25824773  T
105 tgtactctgatagctgtgtgatgttaagcaattgaacattcaaacctctagttttcaaatcttctagaacattttcaaccacttgcatcattttagg 201  Q
    |||| ||||| || |||||||||||||||| ||||||||| |||||| | ||||||||||| || || || || || ||||||||||||||||||||    
25824772 tgtattctgagagttgtgtgatgttaagcatttgaacatttaaaccttttgttttcaaatcatcaagcaccttctccaccacttgcatcattttagg 25824676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 137249 times since January 2019
Visitors: 1446