View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_14 (Length: 271)

Name: NF0920_high_14
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_14
NF0920_high_14
[»] chr2 (13 HSPs)
chr2 (45-271)||(9030084-9030311)
chr2 (126-232)||(9026536-9026643)
chr2 (126-232)||(9031803-9031910)
chr2 (126-268)||(8991916-8992058)
chr2 (108-232)||(9016222-9016345)
chr2 (150-232)||(8975455-8975536)
chr2 (126-232)||(9023171-9023276)
chr2 (126-206)||(8988193-8988272)
chr2 (126-232)||(9020606-9020710)
chr2 (126-222)||(8973079-8973176)
chr2 (47-103)||(9016146-9016203)
chr2 (159-232)||(8996134-8996206)
chr2 (58-123)||(9020153-9020216)
[»] chr1 (1 HSPs)
chr1 (126-232)||(33987813-33987918)


Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 13)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 45 - 271
Target Start/End: Original strand, 9030084 - 9030311
Alignment:
45 tcagatcttgagttattattgtttatttcattccgtatgtttctt-atttatgcttagaagaactagtataaattatccaacaagaatcagatcgtgata 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030084 tcagatcttgagttattattgtttatttcattccgtatgtttctttatttatgcttagaagaactagtataaattatccaacaagaatcagatcgtgata 9030183  T
144 tttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattgatgataatagaggaagaaa 243  Q
    ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030184 tttggctttaagacaagaatatcaatttaattttttgacaattcatcatgatggcctatgtgtgtctatttactctgattgatgataatagaggaagaaa 9030283  T
244 gtgttaggaagagtctaccaagcaagct 271  Q
    ||||||||||||||||||||||||||||    
9030284 gtgttaggaagagtctaccaagcaagct 9030311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9026536 - 9026643
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtcta--tttactctgatt 223  Q
    |||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||| ||  ||||||||||||    
9026536 aagaataagatcatgatattttgctttaagacaagaatatcaatttaa-tttttggcaattcatcacgatggcctatgtgtgtgtatttttactctgatt 9026634  T
224 gatgataat 232  Q
    |||||||||    
9026635 gatgataat 9026643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9031803 - 9031910
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtcta--tttactctgatt 223  Q
    |||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||| ||  ||||||||||||    
9031803 aagaataagatcatgatattttgctttaagacaagaatatcaatttaa-tttttggcaattcatcacgatggcctatgtgtgtgtatttttactctgatt 9031901  T
224 gatgataat 232  Q
    |||||||||    
9031902 gatgataat 9031910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 126 - 268
Target Start/End: Original strand, 8991916 - 8992058
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttgg-caagtcatcatgatggcctatgtgtgtctatttactctgattg 224  Q
    |||||||||||| |||||||| |||||||||||||||||||||||||||||||    ||| |||| |||||||||||||||| | |||||||||||||      
8991916 aagaatcagatcatgatattttgctttaagacaagaatatcaatttaatttttgcttcaattcataatgatggcctatgtgtatgtatttactctgat-- 8992013  T
225 atgataatagaggaagaaagtgttagga--agagtctaccaagcaa 268  Q
      |||||  ||| |||| ||||||||||  ||||||||||||||||    
8992014 -cgataaaggagaaagagagtgttaggaagagagtctaccaagcaa 8992058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 108 - 232
Target Start/End: Original strand, 9016222 - 9016345
Alignment:
108 tagtataaattatccaacaagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtg 207  Q
    ||||||||||||| ||| |||| ||||||| |||||||| ||| ||||||||||||||||||||||||||||  ||| |||| ||  ||||| ||||||     
9016222 tagtataaattattcaataagagtcagatcatgatattttgctataagacaagaatatcaatttaatttttt-tcaattcataatcgtggcccatgtgta 9016320  T
208 tctatttactctgattgatgataat 232  Q
    | |||||||||| ||||||||||||    
9016321 tgtatttactctaattgatgataat 9016345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 150 - 232
Target Start/End: Original strand, 8975455 - 8975536
Alignment:
150 tttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattgatgataat 232  Q
    |||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||| | |||||||||||||||||||||||    
8975455 tttaagactagaatatcaatttaattgtt-ggcaattcatcatgatggcctatgtgtatgtatttactctgattgatgataat 8975536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9023171 - 9023276
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattga 225  Q
    |||||||||||| ||||| || |||||||| ||||||||||||||||| |||||||||| ||||| |||||||||| |||| | |||||||| |||||||    
9023171 aagaatcagatcatgatactttgctttaagtcaagaatatcaatttaa-tttttggcaattcatcgtgatggcctaggtgtatgtatttactatgattga 9023269  T
226 tgataat 232  Q
    | |||||    
9023270 tcataat 9023276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 126 - 206
Target Start/End: Original strand, 8988193 - 8988272
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgt 206  Q
    |||||||||||| |||||||| || ||||||||||||||||||||| | |||||||||| |||||||||||||||||||||    
8988193 aagaatcagatcatgatattttgccttaagacaagaatatcaatttta-tttttggcaattcatcatgatggcctatgtgt 8988272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 9020606 - 9020710
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattga 225  Q
    ||||||| |||| |||||||| |||||||||| ||||||||||||||| |||||||||| ||| |||| ||||| |||||| | ||| |||| |||||||    
9020606 aagaatccgatcatgatattttgctttaagacgagaatatcaatttaa-tttttggcaattcaccatg-tggccaatgtgtatgtatctactttgattga 9020703  T
226 tgataat 232  Q
    |||||||    
9020704 tgataat 9020710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 222
Target Start/End: Original strand, 8973079 - 8973176
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttt-tggcaagtcatcatgatggcctatgtgtgtctatttactctgat 222  Q
    |||||||||||| |||||||| |||| ||||||||||||||||||||||||||    ||| |||| ||| ||||||||||||   |||||||||||||    
8973079 aagaatcagatcatgatattttgcttcaagacaagaatatcaatttaatttttgcttcaattcataatggtggcctatgtgtaagtatttactctgat 8973176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 47 - 103
Target Start/End: Original strand, 9016146 - 9016203
Alignment:
47 agatcttgagttattattgtttatttcattccgtatgtttc-ttatttatgcttagaa 103  Q
    |||||||||||||||  ||||||||||||||| |||||||| ||||||||||||||||    
9016146 agatcttgagttattggtgtttatttcattccatatgtttctttatttatgcttagaa 9016203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 159 - 232
Target Start/End: Original strand, 8996134 - 8996206
Alignment:
159 agaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattgatgataat 232  Q
    ||||||| |||||||||||| ||||| ||| ||||||||||||||| | | ||| |||| ||||||||||||||    
8996134 agaatattaatttaattttt-ggcaattcaccatgatggcctatgtttatgtatctactatgattgatgataat 8996206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 123
Target Start/End: Original strand, 9020153 - 9020216
Alignment:
58 tattattgtttatttcattccgtatgtttctt-atttatgcttagaagaactagtataaattatcca 123  Q
    |||| |||||| ||||||||| |||||||||| ||||||||||   |||||||||||||| ||||||    
9020153 tattgttgtttctttcattccttatgtttcttaatttatgctt---agaactagtataaactatcca 9020216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 33987813 - 33987918
Alignment:
126 aagaatcagatcgtgatatttggctttaagacaagaatatcaatttaattttttggcaagtcatcatgatggcctatgtgtgtctatttactctgattga 225  Q
    |||||||||||| |||||||| ||| |||||||||||||| |||||||||||| ||||| |||||||||||| |||||||| | ||| ||||||||||||    
33987813 aagaatcagatcatgatattttgctgtaagacaagaatattaatttaattttt-ggcaattcatcatgatggactatgtgtatgtatctactctgattga 33987911  T
226 tgataat 232  Q
    |||||||    
33987912 tgataat 33987918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142508 times since January 2019
Visitors: 1480