View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_15 (Length: 254)

Name: NF0920_high_15
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_15
NF0920_high_15
[»] chr3 (2 HSPs)
chr3 (12-239)||(11394042-11394269)
chr3 (12-239)||(46233766-46233993)
[»] chr2 (1 HSPs)
chr2 (12-239)||(9208594-9208821)
[»] chr1 (1 HSPs)
chr1 (12-239)||(32440452-32440679)
[»] chr7 (1 HSPs)
chr7 (12-239)||(16262485-16262712)
[»] chr5 (2 HSPs)
chr5 (12-66)||(21592442-21592496)
chr5 (12-66)||(21596559-21596613)


Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 239
Target Start/End: Complemental strand, 11394269 - 11394042
Alignment:
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
11394269 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaaacattggaattaacaa 11394170  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11394169 tgcaaacattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 11394070  T
212 gggttttggagtgataattggagtgtta 239  Q
    ||||||||||||||||||||||||||||    
11394069 gggttttggagtgataattggagtgtta 11394042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 46233766 - 46233993
Alignment:
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
46233766 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 46233865  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46233866 tgcaaacattggaactatgcacgcgtttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 46233965  T
212 gggttttggagtgataattggagtgtta 239  Q
    ||||||||||||||||||||||||||||    
46233966 gggttttggagtgataattggagtgtta 46233993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 239
Target Start/End: Complemental strand, 9208821 - 9208594
Alignment:
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
9208821 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 9208722  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9208721 tgcaaacattggaactatgcacgcgtttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 9208622  T
212 gggttttggagtgataattggagtgtta 239  Q
    ||||||||||||||||||||||||||||    
9208621 gggttttggagtgataattggagtgtta 9208594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 32440452 - 32440679
Alignment:
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
32440452 agagagggaggagagaaagcgacgatgaagagggtgggtcggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 32440551  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| |||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32440552 tgcaaacattgaaactatgcacacgtttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 32440651  T
212 gggttttggagtgataattggagtgtta 239  Q
    ||||||||||||||||||||||||||||    
32440652 gggttttggagtgataattggagtgtta 32440679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 16262485 - 16262712
Alignment:
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgttttacgatatgcattacattggtaaccaaaacattggaattaacaa 111  Q
    |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
16262485 agagagggaggagagaaagcaacaatgaagagggtgggttggagaggttgttgttttactatatgcattacattggtaaccaaagcattggaattaacaa 16262584  T
112 tgcaaatattggaactatgcacgcttttcacaaagtttgatataaagggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 211  Q
    |||||| |||| ||| |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
16262585 tgcaaacattgaaacaatgcacgcgtttcacaaagtttgatataaacggctggatcaatccaagggccataattagttggcgcctaaaactttaggatta 16262684  T
212 gggttttggagtgataattggagtgtta 239  Q
    |||||||||||||||||||| |||||||    
16262685 gggttttggagtgataattgaagtgtta 16262712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 21592496 - 21592442
Alignment:
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgtt 66  Q
    |||||||||| ||||| ||||| ||||| ||| ||||||| ||||||||||||||    
21592496 agagagggagaagagatagcgatgatgaggagtgtgggtttgagaggttgttgtt 21592442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 21596613 - 21596559
Alignment:
12 agagagggaggagagaaagcgacgatgaagagggtgggttggagaggttgttgtt 66  Q
    |||||||||| ||||| ||||| ||||| ||| ||||||| ||||||||||||||    
21596613 agagagggagaagagatagcgatgatgaggagtgtgggtttgagaggttgttgtt 21596559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141922 times since January 2019
Visitors: 1479