View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_16 (Length: 251)

Name: NF0920_high_16
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_16
NF0920_high_16
[»] chr6 (1 HSPs)
chr6 (11-251)||(3345972-3346212)


Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 3346212 - 3345972
Alignment:
11 acaatataggatgatctttttgtatgagtatgtttggcattggttacatcaaccttaaattgaattatggaatgcaaagtttatccaaatgatattttac 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||    
3346212 acaatataggatgatctttttgtatgagtatgtttggcattggttacatcaaccttaaattgaattatggaatgctaagtttatccaaatgctattttac 3346113  T
111 acaagttgtgtaaacttatcatacattgataatgatattgttcttttgttttttgaggtgaatgatatgtaatttttcttacggaaacaaactcaacttg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3346112 acaagttgtgtaaacttatcatacattgataatgatattgttcttttgttttttgaggtgaatgatatgtaatttttcttacggaaacaaactcaacttg 3346013  T
211 tttcattaataacaacagtcaaaatataagatgacaattga 251  Q
    |||||||||||||||||||||||||||||||||||||||||    
3346012 tttcattaataacaacagtcaaaatataagatgacaattga 3345972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142134 times since January 2019
Visitors: 1479