View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_17 (Length: 251)

Name: NF0920_high_17
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_17
NF0920_high_17
[»] chr2 (6 HSPs)
chr2 (2-236)||(9030643-9030877)
chr2 (1-237)||(9012964-9013199)
chr2 (1-237)||(9021106-9021337)
chr2 (126-237)||(13046162-13046273)
chr2 (116-213)||(8996946-8997045)
chr2 (124-156)||(8988726-8988758)


Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 2 - 236
Target Start/End: Original strand, 9030643 - 9030877
Alignment:
2 ttactctggacatatatcaaatatatatcaaaatgcaaggtgttgatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaac 101  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030643 ttactctggacatatatcaaatatatatcaaaatccaaggtgtggatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaac 9030742  T
102 aacaaagagtgtatgttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaacag 201  Q
    |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9030743 aacatagagtgtatgttcttgcacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaacag 9030842  T
202 ttgtgtttttgggtgtgctcctgatgatgtccatc 236  Q
    |||||||||||||||||||||| ||||| ||||||    
9030843 ttgtgtttttgggtgtgctcctaatgatatccatc 9030877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 9012964 - 9013199
Alignment:
1 tttactctggacatatatcaaatatatatcaaaatgcaaggtgttgatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaa 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||| |||||||    
9012964 tttactctgggcatatatcaaatatatatcaaaatgcaaggtgtggatagaagttctattttt-cttccctcaatttgtaattgattaaaacaaatagaa 9013062  T
101 caacaaagagtgtatgttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaaca 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
9013063 caacaaagagtgtatgttcttgcacaaagagatattagtatctcacaaaacaaaggttcaacttctggtattccacaatacattatgcaaattgttaaca 9013162  T
201 gttgtgtttttgggtgtgctcctgatgatgtccatct 237  Q
     |||||||||||| ||||||||| ||||| |||||||    
9013163 cttgtgtttttggatgtgctcctaatgatatccatct 9013199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 9021106 - 9021337
Alignment:
1 tttactctggacatatatcaaatatatatcaaaatgcaaggtgttgatagaagttctattttttcttctctcaatttgtaattgattaaaactaatagaa 100  Q
    |||| ||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||    ||||| |||||||    
9021106 tttaatctgggcatatataaaatatatatcaaaatgcatggtgttgatagaagttctattttt-cttctctcaatttgtaatt----aaaacaaatagaa 9021200  T
101 caacaaagagtgtatgttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaaca 200  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||    
9021201 caacaaagagtgtatgttcttgcacaaagagatattagaatctcacaaagcaaaggttcaacttctggtattccacattacattgtgcaaattgttagca 9021300  T
201 gttgtgtttttgggtgtgctcctgatgatgtccatct 237  Q
     |||||||||||| | | ||||| ||||| |||||||    
9021301 cttgtgtttttggatattctcctcatgatatccatct 9021337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 126 - 237
Target Start/End: Complemental strand, 13046273 - 13046162
Alignment:
126 aaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacattatgcaaattgttaacagttgtgtttttgggtgtgctcctga 225  Q
    ||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||| |||||||| ||| ||||||||| |    
13046273 aaagagacattagtatctcacaaagcaaaggttcaacttctggaattccacagtacattgtgcaaattgttaacacttgtgtttctggatgtgctcctta 13046174  T
226 tgatgtccatct 237  Q
    |||| |||||||    
13046173 tgatatccatct 13046162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 116 - 213
Target Start/End: Original strand, 8996946 - 8997045
Alignment:
116 gttcttgaacaaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatac--attatgcaaattgttaacagttgtgtttttgg 213  Q
    ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||| ||| ||||||||||| ||| ||||||||    
8996946 gttcttgcacgaagagatattagtatctcacaaagcaaaggttcaacttctggtattccacaatacatattgtgccaattgttaacacttgcgtttttgg 8997045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 156
Target Start/End: Original strand, 8988726 - 8988758
Alignment:
124 acaaagagatattagtatctcacaaagcaaagg 156  Q
    |||||||||||||||||||||||||||| ||||    
8988726 acaaagagatattagtatctcacaaagcgaagg 8988758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149325 times since January 2019
Visitors: 1516