View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_18 (Length: 234)

Name: NF0920_high_18
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_18
NF0920_high_18
[»] chr4 (2 HSPs)
chr4 (17-143)||(26171554-26171676)
chr4 (135-234)||(26171141-26171240)
[»] chr7 (1 HSPs)
chr7 (14-217)||(42448314-42448510)
[»] chr1 (2 HSPs)
chr1 (14-151)||(6612997-6613130)
chr1 (202-234)||(6613142-6613174)
[»] chr2 (1 HSPs)
chr2 (91-150)||(21733334-21733393)
[»] chr3 (1 HSPs)
chr3 (91-150)||(3671832-3671891)
[»] chr6 (3 HSPs)
chr6 (121-218)||(26064369-26064459)
chr6 (121-218)||(26084338-26084428)
chr6 (154-216)||(25516101-25516164)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 143
Target Start/End: Complemental strand, 26171676 - 26171554
Alignment:
17 taaatatgaattccagaaatgtcttaagctgcatatataacttcgaaacaggaacaaattgtttctctatgtattgggttcatggcatgataacttggtg 116  Q
    |||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
26171676 taaatatgaattccagaaatgtcttaagctgcata----acttcgaaacaggaacaaattgttgctctatgtattgggttcatggcatgataacttggtg 26171581  T
117 ttgaaagagattactgcataaagtgaa 143  Q
    |||||||||||||||||||||||||||    
26171580 ttgaaagagattactgcataaagtgaa 26171554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 135 - 234
Target Start/End: Complemental strand, 26171240 - 26171141
Alignment:
135 taaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttctttatatcattaaggtt 234  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26171240 taaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttctttatatcattaaggtt 26171141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 42448510 - 42448314
Alignment:
14 taataaatatgaattccagaaatgtcttaagctgcatatataacttcgaaacaggaa-caaattgtttctctatgtattgggttcatggcatgataactt 112  Q
    ||||||||| ||| ||||| ||||| ||||||||||||    ||||| ||||||||| ||  ||||| ||||| |||||| ||||||||||||| |||||    
42448510 taataaataagaaatccagtaatgtgttaagctgcata----acttccaaacaggaagcactttgttgctctaagtattgtgttcatggcatgacaactt 42448415  T
113 ggtgttgaaagagattactgcataaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttga 212  Q
    |||||||||||||||| ||||| |  |||||||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||| |||||||||||    
42448414 ggtgttgaaagagattgctgcaga--gtgaatatagtagcagagcttgtggttctaa--atgtgtttttatctctttatatcaaattggtgcaattttga 42448319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 14 - 151
Target Start/End: Original strand, 6612997 - 6613130
Alignment:
14 taataaatatgaattccagaaatgtcttaagctgcatatataacttcgaaacaggaacaaattgtttctctatgtattgggttcatggcatgataacttg 113  Q
    ||||||||||||||||||| ||||| ||||||||||||    ||||| |||||| | || | |||| ||||||||||||||||||||||| || ||||||    
6612997 taataaatatgaattccaggaatgtgttaagctgcata----acttccaaacagaagcacaatgttgctctatgtattgggttcatggcacgacaacttg 6613092  T
114 gtgttgaaagagattactgcataaagtgaatatagtag 151  Q
    |||||||||||||| |||||||||||||||||||||||    
6613093 gtgttgaaagagatcactgcataaagtgaatatagtag 6613130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 234
Target Start/End: Original strand, 6613142 - 6613174
Alignment:
202 tgcaattttgactttctttatatcattaaggtt 234  Q
    |||||||||||||||||||||||||| ||||||    
6613142 tgcaattttgactttctttatatcatcaaggtt 6613174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 91 - 150
Target Start/End: Original strand, 21733334 - 21733393
Alignment:
91 tgggttcatggcatgataacttggtgttgaaagagattactgcataaagtgaatatagta 150  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
21733334 tgggttcatggcatgataacttggtgttgaaaaagattactgcataaagtgaatatagta 21733393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 91 - 150
Target Start/End: Complemental strand, 3671891 - 3671832
Alignment:
91 tgggttcatggcatgataacttggtgttgaaagagattactgcataaagtgaatatagta 150  Q
    ||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||    
3671891 tgggttcttggcatgacaacttggtgttgaaagatattactgcataaagtgaatatagta 3671832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 218
Target Start/End: Original strand, 26064369 - 26064459
Alignment:
121 aagagattactgcataaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttct 218  Q
    ||||| ||| |||| ||||||||||||||     ||||||||||||||||| |||   |||| ||||||||||||||||| ||||||||| |||||||    
26064369 aagaggttaatgcagaaagtgaatatagtt----agtttgtggttctaattgtgt---tttacctctttatatcaaattggtgcaatttttactttct 26064459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 121 - 218
Target Start/End: Original strand, 26084338 - 26084428
Alignment:
121 aagagattactgcataaagtgaatatagtagcagagtttgtggttctaattatgtgtttttatctctttatatcaaattgctgcaattttgactttct 218  Q
    ||||| ||| |||| ||||||||||||||     ||||||||||||||||| |||   |||| ||||||||||||||||| ||||||||| |||||||    
26084338 aagaggttaatgcagaaagtgaatatagtt----agtttgtggttctaattgtgt---tttacctctttatatcaaattggtgcaatttttactttct 26084428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 216
Target Start/End: Original strand, 25516101 - 25516164
Alignment:
154 gagtttgtggttctaattatgtgttttt-atctctttatatcaaattgctgcaattttgacttt 216  Q
    |||||||||||||||| | ||| ||||| ||| ||||||||||||||| ||||||||| |||||    
25516101 gagtttgtggttctaaatgtgttttttttatcgctttatatcaaattggtgcaatttttacttt 25516164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142387 times since January 2019
Visitors: 1480