View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_19 (Length: 232)

Name: NF0920_high_19
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF0920_high_19
[»] chr7 (1 HSPs)
chr7 (1-232)||(25015084-25015315)
[»] chr8 (1 HSPs)
chr8 (56-232)||(12662793-12662971)
[»] chr4 (1 HSPs)
chr4 (161-227)||(5129633-5129699)

Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 25015315 - 25015084
1 ctgattgttacttcaaatattgcagacaaattgacttcttcactggtcctacaggtatataaaattgttcattattcattaattaatgtaaattttgatc 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
25015315 ctgattgttacttcaaatattgcagacaaattgccttcttcactggtcctacaggtatataaaattgttcattattccttaattaatgtaaattttgatc 25015216  T
101 taaattgaatataattgattatgtggaactaaaatttacgtattctctattattacagttggaggacttcttaatgcaacatgtgggaatattaccgagc 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
25015215 taaattgaatataattgattatgtggaactaaaatttatgtattctctattattacagttggaggacttcttaatgcaacatgtgggaatattactgagc 25015116  T
201 tgatcatagcaatatttgctcttagcagcaac 232  Q
25015115 tgatcatagcaatatttgctcttagcagcaac 25015084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 56 - 232
Target Start/End: Complemental strand, 12662971 - 12662793
56 tatataaaattgttcattattcattaattaatgta-aattttgatctaaattgaatataattgattatgtggaactaaaa-tttacgtattctctattat 153  Q
    ||||||||||||||||| | ||||| ||||||||  |||||||| ||||  | |||||||||||||||||| | |||||  |||| | ||||||||||||    
12662971 tatataaaattgttcataactcattgattaatgtttaattttgaactaagctaaatataattgattatgtgaagctaaatgtttatgcattctctattat 12662872  T
154 tacagttggaggacttcttaatgcaacatgtgggaatattaccgagctgatcatagcaatatttgctcttagcagcaac 232  Q
    |||||||||||| |||||||||||||||| |||||||||||| ||| ||||  ||||||||||||||||||||||||||    
12662871 tacagttggagggcttcttaatgcaacatttgggaatattactgagttgatagtagcaatatttgctcttagcagcaac 12662793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 227
Target Start/End: Original strand, 5129633 - 5129699
161 ggaggacttcttaatgcaacatgtgggaatattaccgagctgatcatagcaatatttgctcttagca 227  Q
    ||||||||| | ||||||||||||||||||  ||| || || ||||| ||||||||||| |||||||    
5129633 ggaggacttttgaatgcaacatgtgggaatgctacagaactcatcattgcaatatttgcacttagca 5129699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142474 times since January 2019
Visitors: 1480