View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_2 (Length: 554)

Name: NF0920_high_2
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_2
NF0920_high_2
[»] chr2 (1 HSPs)
chr2 (75-546)||(15885619-15886089)
[»] chr6 (1 HSPs)
chr6 (408-541)||(28958926-28959059)
[»] chr8 (1 HSPs)
chr8 (257-308)||(8942306-8942357)


Alignment Details
Target: chr2 (Bit Score: 444; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 444; E-Value: 0
Query Start/End: Original strand, 75 - 546
Target Start/End: Complemental strand, 15886089 - 15885619
Alignment:
75 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15886089 gcattagtgcaaattttgacaccattaatatcaccattagcttttgcttttcagataaaaacagataaacctttctcgtaaataatgaataagtagggag 15885990  T
175 agaggggtctccttgccttaaccctctaccagaaataaaaggaacaggtgtgctaccattaaacaaaatagaataatttacggtttcaacacacatcata 274  Q
    |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15885989 agaggggtctccttgccttaaccctctaccaggaataaaaggtacaggtgtgctaccattaaacaaaatagaataatttacggtttcaacacacatcata 15885890  T
275 atccatttgttctattgatgagagaaactcatttccatcataacccctttgagataattcaagtcaattatgtcctatgtcttgctaatatcaagcttca 374  Q
    ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
15885889 atccatt-gttctattgatgagaaaaactcatttccatcataacccctttgagataattcaagtcaattatgtccgatgtcttgctaatatcaagcttca 15885791  T
375 aaacaacatcgccatattttcctctaacttttacatagagcaataggtcacaaatctttcatagaaacttggaattcaccttttggaattagggcgatgt 474  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15885790 aaacaacatcgccatattttcctctaacttttacatagagcaataggtcacaaatctttcatagaaacttggaattcaccttttggaattagggcgatgt 15885691  T
475 ttgtcatgttgacggttgatgggaaaatacatgtcaaaagccaaccacaccattgattacaaatttcatctc 546  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15885690 ttttcatgttgacggttgatgggaaaatacatgtcaaaagccaaccacaccattgattacaaatttcatctc 15885619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 408 - 541
Target Start/End: Complemental strand, 28959059 - 28958926
Alignment:
408 catagagcaataggtcacaaatctttcatagaaacttggaattcaccttttggaattagggcgatgtttgtcatgttgacggttgatgggaaaatacatg 507  Q
    |||||||||||||||||| |||||||||||||||||| | | ||||||||| | |||||||  ||||||||||| || | ||||||||||||| || |||    
28959059 catagagcaataggtcactaatctttcatagaaactttggactcacctttttggattagggatatgtttgtcatatttaaggttgatgggaaagtaaatg 28958960  T
508 tcaaaagccaaccacaccattgattacaaatttc 541  Q
    |  |||||||||| ||  |||||||| |||||||    
28958959 ttgaaagccaaccgcaatattgattaaaaatttc 28958926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 257 - 308
Target Start/End: Complemental strand, 8942357 - 8942306
Alignment:
257 gtttcaacacacatcataatccatttgttctattgatgagagaaactcattt 308  Q
    ||||| ||||||||||| ||||| ||| ||||||||||||| ||||||||||    
8942357 gtttctacacacatcatgatccacttgatctattgatgagataaactcattt 8942306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142283 times since January 2019
Visitors: 1480