View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_22 (Length: 204)

Name: NF0920_high_22
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_22
NF0920_high_22
[»] chr6 (3 HSPs)
chr6 (1-190)||(14534530-14534719)
chr6 (1-190)||(14530181-14530370)
chr6 (3-190)||(14517020-14517207)
[»] chr3 (2 HSPs)
chr3 (2-99)||(37339837-37339935)
chr3 (1-100)||(37328604-37328700)


Alignment Details
Target: chr6 (Bit Score: 178; Significance: 3e-96; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 14534530 - 14534719
Alignment:
1 attgtgggttaaattacaaaaataattaccacgaaaacaacctggaatccttgttaaaataatcacttaagtcgacgaatcaagcattcactttcacggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||    
14534530 attgtgggttaaattacaaaaataattaccacgaaaacaacctggaatctgtgttaaaataatcacttaagtcgacgaatcaagcattcactttcacggt 14534629  T
101 caaaccaaagtatgctattcggtaaaattcataacacatatatcaatgtttaagacctatagtacctgccagtcgaagatgtgatgatgt 190  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14534630 taaaccaaagtatgctattcggtaaaattcataacacatatatcaatgtttaagacctatagtacctgccagtcgaagatgtgatgatgt 14534719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 14530181 - 14530370
Alignment:
1 attgtgggttaaattacaaaaataattaccacgaaaacaacctggaatccttgttaaaataatcacttaagtcgacgaatcaagcattcactttcacggt 100  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14530181 attgtgggttaaattacaaaaataataaccacgaaaacaacctggaatccttgttaaaataatcacttaagtcgacgaatcaagcattcactttcacggt 14530280  T
101 caaaccaaagtatgctattcggtaaaattcataacacatatatcaatgtttaagacctatagtacctgccagtcgaagatgtgatgatgt 190  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||| |||||||||||||||    
14530281 caaaccaaagtatgctattcggtaaaattcataacacatatatcgatgtttaaaacctatactacctgccagtcaaagatgtgatgatgt 14530370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 3 - 190
Target Start/End: Original strand, 14517020 - 14517207
Alignment:
3 tgtgggttaaattacaaaaataattaccacgaaaacaacctggaatccttgttaaaataatcacttaagtcgacgaatcaagcattcactttc-acggtc 101  Q
    ||||| |||||||| ||||||||| |  || |||||||| ||||| ||| | ||||||||| ||||||||||||||||||  ||||||||||  |||||     
14517020 tgtggattaaatta-aaaaataataataaccaaaacaacttggaagcctagctaaaataataacttaagtcgacgaatcagacattcactttttacggtt 14517118  T
102 aaaccaaagtatgctattcggtaaaattcataacacatatatcaatgtttaagacctatagtacctgccagtcgaagatgtgatgatgt 190  Q
     ||| ||||||||| ||||   |||||  |||||||||| |||||||||||||| ||||  ||||||||||| || |||||||||||||    
14517119 gaacaaaagtatgccattcatcaaaatatataacacatacatcaatgtttaagaactatgctacctgccagttgaggatgtgatgatgt 14517207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 2 - 99
Target Start/End: Complemental strand, 37339935 - 37339837
Alignment:
2 ttgtgggttaaattacaaaaataattaccacgaaaacaacctggaatccttgttaaaataatcacttaagtcgacgaatcaagcattca-ctttcacgg 99  Q
    ||||||||||||||||||| | ||||||    |||||||||||||| ||||||||||||||| ||||| || ||||||||| ||||||| |||||||||    
37339935 ttgtgggttaaattacaaacaaaattactggcaaaacaacctggaagccttgttaaaataataacttaggttgacgaatcaggcattcacctttcacgg 37339837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 37328700 - 37328604
Alignment:
1 attgtgggttaaattacaaaaataattaccacgaaaacaacctggaatccttgttaaaataatcacttaagtcgacgaatcaagcattcact-ttcacgg 99  Q
    ||||||||||||||||| |||    ||| ||| |||||||||||||| | |||||||||| || ||||| || || |||||| ||||||||| |||||||    
37328700 attgtgggttaaattactaaa----ttatcaccaaaacaacctggaagctttgttaaaattataacttaggttgatgaatcaggcattcactcttcacgg 37328605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149267 times since January 2019
Visitors: 1516