View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0920_high_23 (Length: 202)

Name: NF0920_high_23
Description: NF0920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0920_high_23
NF0920_high_23
[»] chr7 (1 HSPs)
chr7 (1-48)||(44767077-44767124)


Alignment Details
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44767124 - 44767077
Alignment:
1 ttaatttcccgcgaattccttccgcattttaatatcactctcactctc 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
44767124 ttaatttcccgcgaattccttccgcattttaatatcactctcactctc 44767077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149645 times since January 2019
Visitors: 1517